Incidental Mutation 'R9368:Ticrr'
ID 709129
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R9368 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79660196-79698148 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79680987 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 711 (D711G)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: D711G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: D711G

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: D711G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206622
AA Change: D711G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Abcc9 A T 6: 142,694,525 L79H probably damaging Het
Alb A G 5: 90,475,284 T601A probably benign Het
Aldh1l2 A T 10: 83,495,952 L776* probably null Het
Ank3 A G 10: 69,987,499 K666R Het
Ankrd17 T C 5: 90,244,127 T1895A possibly damaging Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Ap2a2 T C 7: 141,627,902 F738L probably benign Het
Ap4m1 T A 5: 138,177,183 C319* probably null Het
Arsj C T 3: 126,439,096 T497M probably damaging Het
Begain G T 12: 109,033,992 S284R probably damaging Het
Bicc1 A T 10: 70,950,087 N408K probably benign Het
Cacybp T C 1: 160,203,638 M207V possibly damaging Het
Cct8l1 A G 5: 25,516,338 D17G probably benign Het
Cd1d1 C A 3: 86,998,632 probably null Het
Chd3 C T 11: 69,360,374 C554Y probably damaging Het
Chsy1 A G 7: 66,171,751 D578G probably damaging Het
Col6a6 T C 9: 105,786,101 Q79R possibly damaging Het
Cpne4 A T 9: 104,686,539 R38S probably damaging Het
Cyp3a57 A G 5: 145,381,349 D380G probably benign Het
Dnah6 A T 6: 73,021,278 S4054T probably benign Het
Emb G T 13: 117,220,560 probably benign Het
Eml5 T C 12: 98,796,578 R1648G probably benign Het
Fam117b A T 1: 59,981,581 M537L probably benign Het
Fcrls C T 3: 87,257,599 V207I possibly damaging Het
Ffar1 A G 7: 30,861,032 S147P probably benign Het
Fgfr3 G A 5: 33,727,872 R110Q probably benign Het
Frmd6 T A 12: 70,887,091 probably null Het
Fry A G 5: 150,477,938 R356G Het
Fsip2 A G 2: 82,980,695 R2453G possibly damaging Het
Glipr1l3 G A 10: 112,148,018 T181I probably benign Het
Hoxc10 A G 15: 102,970,947 I301V possibly damaging Het
Igf2bp2 T A 16: 22,065,145 D463V probably damaging Het
Ints13 T C 6: 146,565,631 D194G probably null Het
Kif5c A T 2: 49,732,780 E548V probably damaging Het
Lrp2 T C 2: 69,527,635 D350G probably damaging Het
Lrrc61 T C 6: 48,568,311 S23P possibly damaging Het
Mcpt4 T C 14: 56,061,677 M35V probably damaging Het
Mical1 T A 10: 41,481,306 M369K possibly damaging Het
Mre11a T A 9: 14,825,218 F548L probably benign Het
Muc20 C T 16: 32,794,101 C302Y possibly damaging Het
Nlgn1 T C 3: 25,434,458 D571G probably damaging Het
Nup88 T C 11: 70,967,930 K131E probably damaging Het
Nwd2 A G 5: 63,804,963 D630G probably damaging Het
Olfr187 C T 16: 59,036,315 V141M probably benign Het
Olfr410 A G 11: 74,334,367 L288P probably damaging Het
Olfr805 A T 10: 129,723,012 C177* probably null Het
Pdzd8 A T 19: 59,300,787 L727* probably null Het
Pi16 T A 17: 29,327,878 N475K probably benign Het
Pikfyve G A 1: 65,268,742 A1826T probably damaging Het
Plxna1 A T 6: 89,337,156 S768T probably benign Het
Plxnc1 T A 10: 94,864,737 R656* probably null Het
Poglut1 A G 16: 38,529,488 W308R probably damaging Het
Prmt9 T G 8: 77,559,034 V165G probably benign Het
Ptch2 A G 4: 117,104,772 E102G probably damaging Het
Rpn2 G T 2: 157,299,580 A303S possibly damaging Het
Rttn A C 18: 89,060,452 H1334P probably damaging Het
Sept3 A T 15: 82,279,538 D32V probably damaging Het
Sftpa1 G T 14: 41,132,460 M1I probably null Het
Slc15a2 G A 16: 36,753,718 T591I probably benign Het
Slc18a2 C T 19: 59,274,359 T252I probably benign Het
Smchd1 A G 17: 71,387,076 F1225L probably damaging Het
Sppl2c G A 11: 104,187,735 G454S probably damaging Het
Swt1 A G 1: 151,411,016 S242P possibly damaging Het
Tcaim C A 9: 122,818,863 H148N probably damaging Het
Tgfbr3l T C 8: 4,249,640 V141A probably damaging Het
Trim45 A T 3: 100,925,003 Q184L possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp25 G A 16: 77,107,955 R803H probably damaging Het
Vmn2r71 T A 7: 85,624,234 M752K probably damaging Het
Wdr35 G A 12: 9,021,826 V893I probably benign Het
Zdhhc7 G T 8: 120,087,755 P105Q probably damaging Het
Zfp316 A G 5: 143,264,291 probably null Het
Zfp454 G C 11: 50,873,710 N298K possibly damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6128:Ticrr UTSW 7 79693968 missense probably damaging 1.00
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
R9073:Ticrr UTSW 7 79667931 missense probably benign 0.01
R9090:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79660856 missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79693768 missense possibly damaging 0.89
R9469:Ticrr UTSW 7 79694763 missense probably benign 0.03
R9502:Ticrr UTSW 7 79693849 missense probably benign
R9614:Ticrr UTSW 7 79696006 missense probably damaging 1.00
R9761:Ticrr UTSW 7 79695565 missense probably damaging 1.00
R9779:Ticrr UTSW 7 79679054 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTTCAAATCTAAAAGCTTGCTGT -3'
(R):5'- TCATGTAGAAACAATGCCCAAGAA -3'

Sequencing Primer
(F):5'- GGTAGGCAACAGTTTTCTC -3'
(R):5'- AAGTGCTTGCCTAGAATGCC -3'
Posted On 2022-04-18