Incidental Mutation 'R9368:Ticrr'
ID 709129
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R9368 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79330735 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 711 (D711G)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: D711G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: D711G

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206017
Predicted Effect probably damaging
Transcript: ENSMUST00000206591
AA Change: D711G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000206622
AA Change: D711G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Abcc9 A T 6: 142,640,251 (GRCm39) L79H probably damaging Het
Alb A G 5: 90,623,143 (GRCm39) T601A probably benign Het
Aldh1l2 A T 10: 83,331,816 (GRCm39) L776* probably null Het
Ank3 A G 10: 69,823,329 (GRCm39) K666R Het
Ankrd17 T C 5: 90,391,986 (GRCm39) T1895A possibly damaging Het
Ankrd17 C T 5: 90,416,508 (GRCm39) R1108Q probably damaging Het
Ap2a2 T C 7: 141,207,815 (GRCm39) F738L probably benign Het
Ap4m1 T A 5: 138,175,445 (GRCm39) C319* probably null Het
Arsj C T 3: 126,232,745 (GRCm39) T497M probably damaging Het
Begain G T 12: 108,999,918 (GRCm39) S284R probably damaging Het
Bicc1 A T 10: 70,785,917 (GRCm39) N408K probably benign Het
Cacybp T C 1: 160,031,208 (GRCm39) M207V possibly damaging Het
Cct8l1 A G 5: 25,721,336 (GRCm39) D17G probably benign Het
Cd1d1 C A 3: 86,905,939 (GRCm39) probably null Het
Chd3 C T 11: 69,251,200 (GRCm39) C554Y probably damaging Het
Chsy1 A G 7: 65,821,499 (GRCm39) D578G probably damaging Het
Col6a6 T C 9: 105,663,300 (GRCm39) Q79R possibly damaging Het
Cpne4 A T 9: 104,563,738 (GRCm39) R38S probably damaging Het
Cyp3a57 A G 5: 145,318,159 (GRCm39) D380G probably benign Het
Dnah6 A T 6: 72,998,261 (GRCm39) S4054T probably benign Het
Emb G T 13: 117,357,096 (GRCm39) probably benign Het
Eml5 T C 12: 98,762,837 (GRCm39) R1648G probably benign Het
Fam117b A T 1: 60,020,740 (GRCm39) M537L probably benign Het
Fcrl2 C T 3: 87,164,906 (GRCm39) V207I possibly damaging Het
Ffar1 A G 7: 30,560,457 (GRCm39) S147P probably benign Het
Fgfr3 G A 5: 33,885,216 (GRCm39) R110Q probably benign Het
Frmd6 T A 12: 70,933,865 (GRCm39) probably null Het
Fry A G 5: 150,401,403 (GRCm39) R356G Het
Fsip2 A G 2: 82,811,039 (GRCm39) R2453G possibly damaging Het
Glipr1l3 G A 10: 111,983,923 (GRCm39) T181I probably benign Het
Hoxc10 A G 15: 102,879,382 (GRCm39) I301V possibly damaging Het
Igf2bp2 T A 16: 21,883,895 (GRCm39) D463V probably damaging Het
Ints13 T C 6: 146,467,129 (GRCm39) D194G probably null Het
Kif5c A T 2: 49,622,792 (GRCm39) E548V probably damaging Het
Lrp2 T C 2: 69,357,979 (GRCm39) D350G probably damaging Het
Lrrc61 T C 6: 48,545,245 (GRCm39) S23P possibly damaging Het
Mcpt4 T C 14: 56,299,134 (GRCm39) M35V probably damaging Het
Mical1 T A 10: 41,357,302 (GRCm39) M369K possibly damaging Het
Mre11a T A 9: 14,736,514 (GRCm39) F548L probably benign Het
Muc20 C T 16: 32,614,471 (GRCm39) C302Y possibly damaging Het
Nlgn1 T C 3: 25,488,622 (GRCm39) D571G probably damaging Het
Nup88 T C 11: 70,858,756 (GRCm39) K131E probably damaging Het
Nwd2 A G 5: 63,962,306 (GRCm39) D630G probably damaging Het
Or3a1 A G 11: 74,225,193 (GRCm39) L288P probably damaging Het
Or5h19 C T 16: 58,856,678 (GRCm39) V141M probably benign Het
Or6c212 A T 10: 129,558,881 (GRCm39) C177* probably null Het
Pdzd8 A T 19: 59,289,219 (GRCm39) L727* probably null Het
Pi16 T A 17: 29,546,852 (GRCm39) N475K probably benign Het
Pikfyve G A 1: 65,307,901 (GRCm39) A1826T probably damaging Het
Plxna1 A T 6: 89,314,138 (GRCm39) S768T probably benign Het
Plxnc1 T A 10: 94,700,599 (GRCm39) R656* probably null Het
Poglut1 A G 16: 38,349,850 (GRCm39) W308R probably damaging Het
Prmt9 T G 8: 78,285,663 (GRCm39) V165G probably benign Het
Ptch2 A G 4: 116,961,969 (GRCm39) E102G probably damaging Het
Rpn2 G T 2: 157,141,500 (GRCm39) A303S possibly damaging Het
Rttn A C 18: 89,078,576 (GRCm39) H1334P probably damaging Het
Septin3 A T 15: 82,163,739 (GRCm39) D32V probably damaging Het
Sftpa1 G T 14: 40,854,417 (GRCm39) M1I probably null Het
Slc15a2 G A 16: 36,574,080 (GRCm39) T591I probably benign Het
Slc18a2 C T 19: 59,262,791 (GRCm39) T252I probably benign Het
Smchd1 A G 17: 71,694,071 (GRCm39) F1225L probably damaging Het
Sppl2c G A 11: 104,078,561 (GRCm39) G454S probably damaging Het
Swt1 A G 1: 151,286,767 (GRCm39) S242P possibly damaging Het
Tcaim C A 9: 122,647,928 (GRCm39) H148N probably damaging Het
Tgfbr3l T C 8: 4,299,640 (GRCm39) V141A probably damaging Het
Trim45 A T 3: 100,832,319 (GRCm39) Q184L possibly damaging Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Usp25 G A 16: 76,904,843 (GRCm39) R803H probably damaging Het
Vmn2r71 T A 7: 85,273,442 (GRCm39) M752K probably damaging Het
Wdr35 G A 12: 9,071,826 (GRCm39) V893I probably benign Het
Zdhhc7 G T 8: 120,814,494 (GRCm39) P105Q probably damaging Het
Zfp316 A G 5: 143,250,046 (GRCm39) probably null Het
Zfp454 G C 11: 50,764,537 (GRCm39) N298K possibly damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGTTCAAATCTAAAAGCTTGCTGT -3'
(R):5'- TCATGTAGAAACAATGCCCAAGAA -3'

Sequencing Primer
(F):5'- GGTAGGCAACAGTTTTCTC -3'
(R):5'- AAGTGCTTGCCTAGAATGCC -3'
Posted On 2022-04-18