Incidental Mutation 'R0745:Evc'
ID70913
Institutional Source Beutler Lab
Gene Symbol Evc
Ensembl Gene ENSMUSG00000029122
Gene NameEvC ciliary complex subunit 1
Synonyms
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R0745 (G1)
Quality Score210
Status Validated
Chromosome5
Chromosomal Location37289098-37336894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37319059 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 205 (V205E)
Ref Sequence ENSEMBL: ENSMUSP00000109791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031005] [ENSMUST00000114148] [ENSMUST00000114154]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031005
AA Change: V382E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031005
Gene: ENSMUSG00000029122
AA Change: V382E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
low complexity region 640 652 N/A INTRINSIC
low complexity region 670 682 N/A INTRINSIC
coiled coil region 694 725 N/A INTRINSIC
low complexity region 772 786 N/A INTRINSIC
coiled coil region 871 911 N/A INTRINSIC
low complexity region 927 944 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114148
AA Change: V382E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109785
Gene: ENSMUSG00000029122
AA Change: V382E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 77 92 N/A INTRINSIC
low complexity region 173 183 N/A INTRINSIC
low complexity region 449 472 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114154
AA Change: V205E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109791
Gene: ENSMUSG00000029122
AA Change: V205E

DomainStartEndE-ValueType
low complexity region 272 295 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 493 505 N/A INTRINSIC
coiled coil region 517 548 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
coiled coil region 694 734 N/A INTRINSIC
low complexity region 750 767 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154885
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a leucine zipper and a transmembrane domain. This gene has been implicated in both Ellis-van Creveld syndrome (EvC) and Weyers acrodental dysostosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some lethality shortly after birth and exhibit aphagia, infertile, teeth abnormalities, short limbs and long bones, delays in ossification, and short ribs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Evc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Evc APN 5 37333013 missense probably damaging 1.00
IGL01799:Evc APN 5 37324914 missense possibly damaging 0.46
IGL01806:Evc APN 5 37320234 critical splice donor site probably null
IGL01823:Evc APN 5 37328521 missense probably damaging 1.00
IGL02821:Evc APN 5 37326396 missense probably benign 0.01
R0312:Evc UTSW 5 37328541 missense possibly damaging 0.83
R0355:Evc UTSW 5 37316312 splice site probably benign
R0741:Evc UTSW 5 37326395 missense possibly damaging 0.51
R1498:Evc UTSW 5 37323700 missense possibly damaging 0.66
R1517:Evc UTSW 5 37319035 missense probably damaging 1.00
R2680:Evc UTSW 5 37310237 missense probably benign
R2867:Evc UTSW 5 37316275 intron probably benign
R4585:Evc UTSW 5 37323713 missense probably damaging 0.96
R4586:Evc UTSW 5 37323713 missense probably damaging 0.96
R4731:Evc UTSW 5 37323797 missense probably benign 0.38
R4859:Evc UTSW 5 37300909 missense probably damaging 0.96
R4963:Evc UTSW 5 37322049 critical splice donor site probably null
R5536:Evc UTSW 5 37326583 splice site probably benign
R5693:Evc UTSW 5 37320240 missense possibly damaging 0.46
R5781:Evc UTSW 5 37326570 missense probably damaging 1.00
R6251:Evc UTSW 5 37300499 missense probably benign
R7061:Evc UTSW 5 37319102 missense possibly damaging 0.66
R7286:Evc UTSW 5 37322183 nonsense probably null
R7503:Evc UTSW 5 37300767 missense unknown
R7831:Evc UTSW 5 37319083 missense probably damaging 1.00
R7914:Evc UTSW 5 37319083 missense probably damaging 1.00
X0012:Evc UTSW 5 37300729 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATGGCTCATAGGATTCCAGGTCCC -3'
(R):5'- GTAACCAGTGGCTGATCCCAAACTC -3'

Sequencing Primer
(F):5'- ATAGGATTCCAGGTCCCCTGTC -3'
(R):5'- TGCTTGGAATGAAgtgtgtgtg -3'
Posted On2013-09-30