Incidental Mutation 'R9368:Wdr35'
ID 709151
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene Name WD repeat domain 35
Synonyms 4930459M12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9368 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 8973892-9028847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 9021826 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 893 (V893I)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113]
AlphaFold Q8BND3
Predicted Effect probably benign
Transcript: ENSMUST00000085745
AA Change: V893I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: V893I

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: V882I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: V882I

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Abcc9 A T 6: 142,694,525 L79H probably damaging Het
Alb A G 5: 90,475,284 T601A probably benign Het
Aldh1l2 A T 10: 83,495,952 L776* probably null Het
Ank3 A G 10: 69,987,499 K666R Het
Ankrd17 T C 5: 90,244,127 T1895A possibly damaging Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Ap2a2 T C 7: 141,627,902 F738L probably benign Het
Ap4m1 T A 5: 138,177,183 C319* probably null Het
Arsj C T 3: 126,439,096 T497M probably damaging Het
Begain G T 12: 109,033,992 S284R probably damaging Het
Bicc1 A T 10: 70,950,087 N408K probably benign Het
Cacybp T C 1: 160,203,638 M207V possibly damaging Het
Cct8l1 A G 5: 25,516,338 D17G probably benign Het
Cd1d1 C A 3: 86,998,632 probably null Het
Chd3 C T 11: 69,360,374 C554Y probably damaging Het
Chsy1 A G 7: 66,171,751 D578G probably damaging Het
Col6a6 T C 9: 105,786,101 Q79R possibly damaging Het
Cpne4 A T 9: 104,686,539 R38S probably damaging Het
Cyp3a57 A G 5: 145,381,349 D380G probably benign Het
Dnah6 A T 6: 73,021,278 S4054T probably benign Het
Emb G T 13: 117,220,560 probably benign Het
Eml5 T C 12: 98,796,578 R1648G probably benign Het
Fam117b A T 1: 59,981,581 M537L probably benign Het
Fcrls C T 3: 87,257,599 V207I possibly damaging Het
Ffar1 A G 7: 30,861,032 S147P probably benign Het
Fgfr3 G A 5: 33,727,872 R110Q probably benign Het
Frmd6 T A 12: 70,887,091 probably null Het
Fry A G 5: 150,477,938 R356G Het
Fsip2 A G 2: 82,980,695 R2453G possibly damaging Het
Glipr1l3 G A 10: 112,148,018 T181I probably benign Het
Hoxc10 A G 15: 102,970,947 I301V possibly damaging Het
Igf2bp2 T A 16: 22,065,145 D463V probably damaging Het
Ints13 T C 6: 146,565,631 D194G probably null Het
Kif5c A T 2: 49,732,780 E548V probably damaging Het
Lrp2 T C 2: 69,527,635 D350G probably damaging Het
Lrrc61 T C 6: 48,568,311 S23P possibly damaging Het
Mcpt4 T C 14: 56,061,677 M35V probably damaging Het
Mical1 T A 10: 41,481,306 M369K possibly damaging Het
Mre11a T A 9: 14,825,218 F548L probably benign Het
Muc20 C T 16: 32,794,101 C302Y possibly damaging Het
Nlgn1 T C 3: 25,434,458 D571G probably damaging Het
Nup88 T C 11: 70,967,930 K131E probably damaging Het
Nwd2 A G 5: 63,804,963 D630G probably damaging Het
Olfr187 C T 16: 59,036,315 V141M probably benign Het
Olfr410 A G 11: 74,334,367 L288P probably damaging Het
Olfr805 A T 10: 129,723,012 C177* probably null Het
Pdzd8 A T 19: 59,300,787 L727* probably null Het
Pi16 T A 17: 29,327,878 N475K probably benign Het
Pikfyve G A 1: 65,268,742 A1826T probably damaging Het
Plxna1 A T 6: 89,337,156 S768T probably benign Het
Plxnc1 T A 10: 94,864,737 R656* probably null Het
Poglut1 A G 16: 38,529,488 W308R probably damaging Het
Prmt9 T G 8: 77,559,034 V165G probably benign Het
Ptch2 A G 4: 117,104,772 E102G probably damaging Het
Rpn2 G T 2: 157,299,580 A303S possibly damaging Het
Rttn A C 18: 89,060,452 H1334P probably damaging Het
Sept3 A T 15: 82,279,538 D32V probably damaging Het
Sftpa1 G T 14: 41,132,460 M1I probably null Het
Slc15a2 G A 16: 36,753,718 T591I probably benign Het
Slc18a2 C T 19: 59,274,359 T252I probably benign Het
Smchd1 A G 17: 71,387,076 F1225L probably damaging Het
Sppl2c G A 11: 104,187,735 G454S probably damaging Het
Swt1 A G 1: 151,411,016 S242P possibly damaging Het
Tcaim C A 9: 122,818,863 H148N probably damaging Het
Tgfbr3l T C 8: 4,249,640 V141A probably damaging Het
Ticrr A G 7: 79,680,987 D711G probably damaging Het
Trim45 A T 3: 100,925,003 Q184L possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp25 G A 16: 77,107,955 R803H probably damaging Het
Vmn2r71 T A 7: 85,624,234 M752K probably damaging Het
Zdhhc7 G T 8: 120,087,755 P105Q probably damaging Het
Zfp316 A G 5: 143,264,291 probably null Het
Zfp454 G C 11: 50,873,710 N298K possibly damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
R9220:Wdr35 UTSW 12 8986000 missense possibly damaging 0.49
R9573:Wdr35 UTSW 12 9028014 missense probably benign 0.00
R9596:Wdr35 UTSW 12 8986092 missense probably benign 0.08
R9773:Wdr35 UTSW 12 8989990 missense probably benign 0.03
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTAGTGGTCACATGTCCCTGTG -3'
(R):5'- ACTTGAACGCACAGATCTGTTC -3'

Sequencing Primer
(F):5'- CACATGTCCCTGTGGAGTTTTG -3'
(R):5'- CAGATCTGTTCTGGTTGGCTAAGC -3'
Posted On 2022-04-18