Incidental Mutation 'R9368:Eml5'
ID 709153
Institutional Source Beutler Lab
Gene Symbol Eml5
Ensembl Gene ENSMUSG00000051166
Gene Name echinoderm microtubule associated protein like 5
Synonyms C130068M19Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock # R9368 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 98786805-98901484 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98796578 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 1648 (R1648G)
Ref Sequence ENSEMBL: ENSMUSP00000152709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]
AlphaFold Q8BQM8
Predicted Effect probably benign
Transcript: ENSMUST00000065716
AA Change: R1601G

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: R1601G

DomainStartEndE-ValueType
Pfam:HELP 1 49 3.3e-21 PFAM
WD40 50 91 6.42e-1 SMART
WD40 94 136 1.08e-4 SMART
WD40 139 178 1.27e-1 SMART
WD40 184 224 2.75e1 SMART
WD40 225 263 2.65e-4 SMART
Blast:WD40 265 312 2e-22 BLAST
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.2e2 SMART
WD40 397 436 8.59e-1 SMART
WD40 444 479 6.6e1 SMART
WD40 505 546 2.74e2 SMART
WD40 552 592 4.8e-2 SMART
low complexity region 609 632 N/A INTRINSIC
Pfam:HELP 656 715 1.4e-20 PFAM
WD40 716 757 1.18e-1 SMART
WD40 760 802 2.84e-4 SMART
WD40 805 844 1.91e1 SMART
WD40 853 891 2.64e2 SMART
WD40 892 929 3.45e-3 SMART
WD40 985 1026 4.55e-3 SMART
WD40 1029 1068 6.39e0 SMART
WD40 1071 1111 5.15e-2 SMART
WD40 1180 1221 1.9e2 SMART
WD40 1227 1267 1.38e0 SMART
low complexity region 1280 1297 N/A INTRINSIC
Pfam:HELP 1335 1410 2.4e-16 PFAM
Blast:WD40 1412 1462 8e-28 BLAST
WD40 1465 1507 1.56e-1 SMART
WD40 1510 1549 2.06e0 SMART
WD40 1558 1597 8.22e1 SMART
WD40 1599 1644 4.26e1 SMART
WD40 1690 1730 2.19e-5 SMART
WD40 1774 1813 5.97e-1 SMART
WD40 1884 1925 2.39e0 SMART
WD40 1931 1971 2.88e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222097
Predicted Effect probably benign
Transcript: ENSMUST00000223282
AA Change: R1648G

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
Abcc9 A T 6: 142,694,525 L79H probably damaging Het
Alb A G 5: 90,475,284 T601A probably benign Het
Aldh1l2 A T 10: 83,495,952 L776* probably null Het
Ank3 A G 10: 69,987,499 K666R Het
Ankrd17 T C 5: 90,244,127 T1895A possibly damaging Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
Ap2a2 T C 7: 141,627,902 F738L probably benign Het
Ap4m1 T A 5: 138,177,183 C319* probably null Het
Arsj C T 3: 126,439,096 T497M probably damaging Het
Begain G T 12: 109,033,992 S284R probably damaging Het
Bicc1 A T 10: 70,950,087 N408K probably benign Het
Cacybp T C 1: 160,203,638 M207V possibly damaging Het
Cct8l1 A G 5: 25,516,338 D17G probably benign Het
Cd1d1 C A 3: 86,998,632 probably null Het
Chd3 C T 11: 69,360,374 C554Y probably damaging Het
Chsy1 A G 7: 66,171,751 D578G probably damaging Het
Col6a6 T C 9: 105,786,101 Q79R possibly damaging Het
Cpne4 A T 9: 104,686,539 R38S probably damaging Het
Cyp3a57 A G 5: 145,381,349 D380G probably benign Het
Dnah6 A T 6: 73,021,278 S4054T probably benign Het
Emb G T 13: 117,220,560 probably benign Het
Fam117b A T 1: 59,981,581 M537L probably benign Het
Fcrls C T 3: 87,257,599 V207I possibly damaging Het
Ffar1 A G 7: 30,861,032 S147P probably benign Het
Fgfr3 G A 5: 33,727,872 R110Q probably benign Het
Frmd6 T A 12: 70,887,091 probably null Het
Fry A G 5: 150,477,938 R356G Het
Fsip2 A G 2: 82,980,695 R2453G possibly damaging Het
Glipr1l3 G A 10: 112,148,018 T181I probably benign Het
Hoxc10 A G 15: 102,970,947 I301V possibly damaging Het
Igf2bp2 T A 16: 22,065,145 D463V probably damaging Het
Ints13 T C 6: 146,565,631 D194G probably null Het
Kif5c A T 2: 49,732,780 E548V probably damaging Het
Lrp2 T C 2: 69,527,635 D350G probably damaging Het
Lrrc61 T C 6: 48,568,311 S23P possibly damaging Het
Mcpt4 T C 14: 56,061,677 M35V probably damaging Het
Mical1 T A 10: 41,481,306 M369K possibly damaging Het
Mre11a T A 9: 14,825,218 F548L probably benign Het
Muc20 C T 16: 32,794,101 C302Y possibly damaging Het
Nlgn1 T C 3: 25,434,458 D571G probably damaging Het
Nup88 T C 11: 70,967,930 K131E probably damaging Het
Nwd2 A G 5: 63,804,963 D630G probably damaging Het
Olfr187 C T 16: 59,036,315 V141M probably benign Het
Olfr410 A G 11: 74,334,367 L288P probably damaging Het
Olfr805 A T 10: 129,723,012 C177* probably null Het
Pdzd8 A T 19: 59,300,787 L727* probably null Het
Pi16 T A 17: 29,327,878 N475K probably benign Het
Pikfyve G A 1: 65,268,742 A1826T probably damaging Het
Plxna1 A T 6: 89,337,156 S768T probably benign Het
Plxnc1 T A 10: 94,864,737 R656* probably null Het
Poglut1 A G 16: 38,529,488 W308R probably damaging Het
Prmt9 T G 8: 77,559,034 V165G probably benign Het
Ptch2 A G 4: 117,104,772 E102G probably damaging Het
Rpn2 G T 2: 157,299,580 A303S possibly damaging Het
Rttn A C 18: 89,060,452 H1334P probably damaging Het
Sept3 A T 15: 82,279,538 D32V probably damaging Het
Sftpa1 G T 14: 41,132,460 M1I probably null Het
Slc15a2 G A 16: 36,753,718 T591I probably benign Het
Slc18a2 C T 19: 59,274,359 T252I probably benign Het
Smchd1 A G 17: 71,387,076 F1225L probably damaging Het
Sppl2c G A 11: 104,187,735 G454S probably damaging Het
Swt1 A G 1: 151,411,016 S242P possibly damaging Het
Tcaim C A 9: 122,818,863 H148N probably damaging Het
Tgfbr3l T C 8: 4,249,640 V141A probably damaging Het
Ticrr A G 7: 79,680,987 D711G probably damaging Het
Trim45 A T 3: 100,925,003 Q184L possibly damaging Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Usp25 G A 16: 77,107,955 R803H probably damaging Het
Vmn2r71 T A 7: 85,624,234 M752K probably damaging Het
Wdr35 G A 12: 9,021,826 V893I probably benign Het
Zdhhc7 G T 8: 120,087,755 P105Q probably damaging Het
Zfp316 A G 5: 143,264,291 probably null Het
Zfp454 G C 11: 50,873,710 N298K possibly damaging Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Other mutations in Eml5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Eml5 APN 12 98873209 splice site probably benign
IGL00473:Eml5 APN 12 98805492 splice site probably benign
IGL01120:Eml5 APN 12 98844019 missense probably benign
IGL01308:Eml5 APN 12 98802313 missense probably damaging 1.00
IGL01790:Eml5 APN 12 98798932 missense probably damaging 1.00
IGL01973:Eml5 APN 12 98863280 missense probably benign
IGL02182:Eml5 APN 12 98802322 missense probably damaging 1.00
IGL02201:Eml5 APN 12 98794424 splice site probably benign
IGL02375:Eml5 APN 12 98844087 missense probably damaging 1.00
IGL02397:Eml5 APN 12 98790674 missense probably benign 0.07
IGL02480:Eml5 APN 12 98876243 missense probably damaging 1.00
IGL02801:Eml5 APN 12 98817845 missense possibly damaging 0.88
IGL02876:Eml5 APN 12 98858841 missense probably damaging 1.00
IGL03104:Eml5 APN 12 98861245 nonsense probably null
IGL03158:Eml5 APN 12 98827514 splice site probably benign
IGL03286:Eml5 APN 12 98860503 missense probably damaging 1.00
IGL03380:Eml5 APN 12 98874647 splice site probably benign
BB010:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
BB020:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R0573:Eml5 UTSW 12 98824772 splice site probably null
R0624:Eml5 UTSW 12 98865479 missense probably damaging 1.00
R0993:Eml5 UTSW 12 98861183 missense probably benign 0.25
R1073:Eml5 UTSW 12 98830973 missense probably damaging 1.00
R1183:Eml5 UTSW 12 98792046 missense probably benign 0.31
R1352:Eml5 UTSW 12 98831003 splice site probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1469:Eml5 UTSW 12 98858823 missense probably benign
R1503:Eml5 UTSW 12 98831174 missense probably damaging 0.99
R1538:Eml5 UTSW 12 98794276 missense probably damaging 0.99
R1689:Eml5 UTSW 12 98830935 missense probably damaging 1.00
R1773:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1775:Eml5 UTSW 12 98852704 splice site probably null
R1791:Eml5 UTSW 12 98887056 missense probably benign 0.31
R1856:Eml5 UTSW 12 98810584 missense probably damaging 1.00
R1919:Eml5 UTSW 12 98798839 missense probably damaging 1.00
R1957:Eml5 UTSW 12 98859961 missense probably damaging 1.00
R1962:Eml5 UTSW 12 98876311 missense probably damaging 0.99
R2033:Eml5 UTSW 12 98791386 missense possibly damaging 0.71
R2035:Eml5 UTSW 12 98794266 missense probably benign 0.33
R2073:Eml5 UTSW 12 98802446 missense probably damaging 0.99
R2143:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2144:Eml5 UTSW 12 98810605 missense probably damaging 1.00
R2158:Eml5 UTSW 12 98843946 splice site probably benign
R2164:Eml5 UTSW 12 98887097 missense probably damaging 0.99
R2175:Eml5 UTSW 12 98876223 nonsense probably null
R2200:Eml5 UTSW 12 98825417 missense probably damaging 1.00
R2234:Eml5 UTSW 12 98841581 missense probably damaging 1.00
R2504:Eml5 UTSW 12 98844105 missense possibly damaging 0.71
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2871:Eml5 UTSW 12 98865401 missense probably damaging 1.00
R2958:Eml5 UTSW 12 98876178 missense possibly damaging 0.74
R3013:Eml5 UTSW 12 98880808 splice site probably null
R3118:Eml5 UTSW 12 98865494 missense probably damaging 0.97
R3735:Eml5 UTSW 12 98855989 missense possibly damaging 0.78
R3856:Eml5 UTSW 12 98816024 missense probably damaging 1.00
R3900:Eml5 UTSW 12 98825523 missense probably damaging 1.00
R3973:Eml5 UTSW 12 98802465 splice site probably benign
R3976:Eml5 UTSW 12 98802465 splice site probably benign
R4105:Eml5 UTSW 12 98841548 splice site probably null
R4107:Eml5 UTSW 12 98841548 splice site probably null
R4108:Eml5 UTSW 12 98841548 splice site probably null
R4109:Eml5 UTSW 12 98841548 splice site probably null
R4258:Eml5 UTSW 12 98865434 missense probably benign 0.01
R4381:Eml5 UTSW 12 98815955 missense possibly damaging 0.93
R4590:Eml5 UTSW 12 98837341 missense possibly damaging 0.91
R4737:Eml5 UTSW 12 98798852 missense probably damaging 1.00
R4775:Eml5 UTSW 12 98802307 missense probably benign 0.05
R4850:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5007:Eml5 UTSW 12 98830965 missense probably damaging 1.00
R5092:Eml5 UTSW 12 98792616 missense probably damaging 1.00
R5123:Eml5 UTSW 12 98874512 missense probably damaging 1.00
R5124:Eml5 UTSW 12 98792042 missense probably damaging 1.00
R5273:Eml5 UTSW 12 98790688 missense probably damaging 1.00
R5369:Eml5 UTSW 12 98858783 missense probably damaging 1.00
R5430:Eml5 UTSW 12 98794158 missense probably damaging 1.00
R5748:Eml5 UTSW 12 98825555 missense probably damaging 0.99
R5769:Eml5 UTSW 12 98790619 missense probably damaging 1.00
R5832:Eml5 UTSW 12 98876188 missense probably benign
R6113:Eml5 UTSW 12 98824674 nonsense probably null
R6131:Eml5 UTSW 12 98861251 missense probably damaging 0.99
R6175:Eml5 UTSW 12 98794456 missense possibly damaging 0.69
R6184:Eml5 UTSW 12 98863129 missense possibly damaging 0.53
R6357:Eml5 UTSW 12 98870884 missense probably damaging 0.98
R6375:Eml5 UTSW 12 98798868
R6528:Eml5 UTSW 12 98824637 missense probably benign 0.18
R6657:Eml5 UTSW 12 98791405 missense probably damaging 0.98
R6717:Eml5 UTSW 12 98827506 missense probably damaging 1.00
R6751:Eml5 UTSW 12 98865400 missense probably damaging 1.00
R6833:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6834:Eml5 UTSW 12 98887024 missense probably damaging 1.00
R6972:Eml5 UTSW 12 98876180 missense probably benign 0.00
R7091:Eml5 UTSW 12 98802474 missense probably benign 0.16
R7353:Eml5 UTSW 12 98825424 missense
R7644:Eml5 UTSW 12 98855944 missense probably benign 0.05
R7694:Eml5 UTSW 12 98792563 missense probably damaging 0.99
R7842:Eml5 UTSW 12 98794135 missense probably damaging 1.00
R7933:Eml5 UTSW 12 98844020 missense possibly damaging 0.87
R8111:Eml5 UTSW 12 98792514 critical splice donor site probably null
R8198:Eml5 UTSW 12 98858886 nonsense probably null
R8482:Eml5 UTSW 12 98876301 missense probably damaging 1.00
R8732:Eml5 UTSW 12 98815959 missense probably damaging 0.99
R8956:Eml5 UTSW 12 98852693 missense possibly damaging 0.69
R8975:Eml5 UTSW 12 98810570 missense probably damaging 0.99
R9131:Eml5 UTSW 12 98858840 missense probably damaging 1.00
R9258:Eml5 UTSW 12 98844117 missense possibly damaging 0.77
R9261:Eml5 UTSW 12 98856028 missense probably damaging 0.99
R9276:Eml5 UTSW 12 98798801 missense probably damaging 0.99
R9301:Eml5 UTSW 12 98882033 nonsense probably null
R9392:Eml5 UTSW 12 98900940 missense probably damaging 1.00
R9393:Eml5 UTSW 12 98876174 missense probably benign 0.35
R9449:Eml5 UTSW 12 98861295 missense probably damaging 1.00
T0722:Eml5 UTSW 12 98841582 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GCACCACTATGTATCATTAAGTACTGC -3'
(R):5'- AGTGCATTGTGATGAATCATGG -3'

Sequencing Primer
(F):5'- GGCTCAAGGAACACCTTA -3'
(R):5'- TGCTTGTGTCAGAAGAAAA -3'
Posted On 2022-04-18