Incidental Mutation 'R0745:Pds5b'
ID70916
Institutional Source Beutler Lab
Gene Symbol Pds5b
Ensembl Gene ENSMUSG00000034021
Gene NamePDS5 cohesin associated factor B
SynonymsAprin, AS3
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150673739-150810690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150805671 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1424 (T1424A)
Ref Sequence ENSEMBL: ENSMUSP00000144572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016569] [ENSMUST00000038900] [ENSMUST00000202170]
Predicted Effect probably benign
Transcript: ENSMUST00000016569
AA Change: T1422A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016569
Gene: ENSMUSG00000034021
AA Change: T1422A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1247 1259 4.14e1 SMART
AT_hook 1285 1297 1.35e2 SMART
low complexity region 1307 1316 N/A INTRINSIC
low complexity region 1318 1329 N/A INTRINSIC
AT_hook 1370 1382 1.46e0 SMART
low complexity region 1437 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038900
AA Change: T1425A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038421
Gene: ENSMUSG00000034021
AA Change: T1425A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1373 1385 1.46e0 SMART
low complexity region 1440 1449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132947
Predicted Effect probably benign
Transcript: ENSMUST00000202170
AA Change: T1424A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144572
Gene: ENSMUSG00000034021
AA Change: T1424A

DomainStartEndE-ValueType
SCOP:d1gw5a_ 244 773 6e-33 SMART
low complexity region 1156 1167 N/A INTRINSIC
AT_hook 1249 1261 4.14e1 SMART
AT_hook 1287 1299 1.35e2 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1320 1331 N/A INTRINSIC
AT_hook 1372 1384 1.46e0 SMART
low complexity region 1439 1448 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the conserved protein complex termed cohesin. The cohesin complex holds together sister chromatids and facilitates accurate chromosome segregation during mitosis and meiosis. This protein is also a negative regulator of cell proliferation and may be a tumor-suppressor gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic and neonatal lethality with cardiac defects, craniofacial abnormalities, axial skeletal defects, shortening of most of the long bones, abnormal enteric nervous system morphology, and decreased germ cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Pds5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Pds5b APN 5 150722542 missense probably benign 0.25
IGL01530:Pds5b APN 5 150792175 missense probably benign 0.38
IGL01812:Pds5b APN 5 150780689 missense probably damaging 1.00
IGL02163:Pds5b APN 5 150756406 missense probably benign 0.00
IGL02730:Pds5b APN 5 150780752 splice site probably benign
IGL02825:Pds5b APN 5 150728970 missense possibly damaging 0.90
IGL03143:Pds5b APN 5 150779257 missense probably damaging 1.00
IGL03379:Pds5b APN 5 150788331 missense probably damaging 1.00
PIT4283001:Pds5b UTSW 5 150778309 missense probably damaging 0.99
R0026:Pds5b UTSW 5 150749830 splice site probably benign
R0197:Pds5b UTSW 5 150754431 missense probably benign 0.28
R0347:Pds5b UTSW 5 150736427 splice site probably benign
R0396:Pds5b UTSW 5 150779275 missense possibly damaging 0.96
R0400:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R0442:Pds5b UTSW 5 150716544 splice site probably benign
R0839:Pds5b UTSW 5 150764962 missense probably benign 0.23
R0866:Pds5b UTSW 5 150739191 splice site probably benign
R1247:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R1330:Pds5b UTSW 5 150761077 missense probably damaging 0.97
R1440:Pds5b UTSW 5 150754417 missense probably damaging 1.00
R1526:Pds5b UTSW 5 150716400 splice site probably null
R2010:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R2051:Pds5b UTSW 5 150748190 missense probably damaging 1.00
R2507:Pds5b UTSW 5 150756428 missense possibly damaging 0.90
R3111:Pds5b UTSW 5 150719907 missense probably damaging 1.00
R3820:Pds5b UTSW 5 150736337 missense possibly damaging 0.94
R3911:Pds5b UTSW 5 150746706 missense probably benign 0.41
R4077:Pds5b UTSW 5 150794359 missense possibly damaging 0.62
R4118:Pds5b UTSW 5 150775354 critical splice acceptor site probably benign
R4342:Pds5b UTSW 5 150800854 missense probably benign 0.17
R4416:Pds5b UTSW 5 150736396 missense probably damaging 1.00
R4503:Pds5b UTSW 5 150728934 missense probably damaging 1.00
R4524:Pds5b UTSW 5 150788316 missense probably damaging 1.00
R4579:Pds5b UTSW 5 150746732 missense probably damaging 0.98
R4623:Pds5b UTSW 5 150800601 missense probably benign 0.37
R4847:Pds5b UTSW 5 150748112 missense probably damaging 1.00
R4885:Pds5b UTSW 5 150716462 missense probably benign 0.21
R5271:Pds5b UTSW 5 150723353 missense possibly damaging 0.46
R5281:Pds5b UTSW 5 150746608 missense probably benign 0.26
R5337:Pds5b UTSW 5 150793597 missense probably benign 0.03
R5635:Pds5b UTSW 5 150778221 missense possibly damaging 0.78
R5677:Pds5b UTSW 5 150716461 missense possibly damaging 0.91
R6005:Pds5b UTSW 5 150769776 splice site probably null
R6139:Pds5b UTSW 5 150800777 missense possibly damaging 0.81
R6225:Pds5b UTSW 5 150746618 missense probably damaging 0.98
R6279:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6300:Pds5b UTSW 5 150723248 missense possibly damaging 0.80
R6666:Pds5b UTSW 5 150778166 missense probably damaging 1.00
R6805:Pds5b UTSW 5 150805561 splice site probably null
R7038:Pds5b UTSW 5 150800760 missense probably benign 0.02
R7046:Pds5b UTSW 5 150749920 missense probably damaging 1.00
R7051:Pds5b UTSW 5 150794282 missense possibly damaging 0.78
R7138:Pds5b UTSW 5 150800677 nonsense probably null
R7255:Pds5b UTSW 5 150796667 missense probably benign 0.33
R7467:Pds5b UTSW 5 150736327 missense probably damaging 0.99
R7488:Pds5b UTSW 5 150723337 missense probably damaging 0.97
R7512:Pds5b UTSW 5 150788342 missense probably damaging 1.00
R7561:Pds5b UTSW 5 150739318 critical splice donor site probably null
R7576:Pds5b UTSW 5 150778261 missense probably damaging 1.00
R7889:Pds5b UTSW 5 150792172 missense probably damaging 1.00
R7972:Pds5b UTSW 5 150792172 missense probably damaging 1.00
R8059:Pds5b UTSW 5 150807835 missense unknown
Predicted Primers PCR Primer
(F):5'- AGAACTGCCCTGTGCTCTACTCAG -3'
(R):5'- TCAGCATTCAGGCGACAGGTTCTC -3'

Sequencing Primer
(F):5'- CTTGAGCCTCGTAGTGAAGAC -3'
(R):5'- ACAGGTTCTCTAGGCATTGC -3'
Posted On2013-09-30