Incidental Mutation 'R0745:Tgfa'
ID70917
Institutional Source Beutler Lab
Gene Symbol Tgfa
Ensembl Gene ENSMUSG00000029999
Gene Nametransforming growth factor alpha
Synonyms
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86195223-86275719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86271435 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 140 (E140K)
Ref Sequence ENSEMBL: ENSMUSP00000032066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032066] [ENSMUST00000192058]
Predicted Effect probably damaging
Transcript: ENSMUST00000032066
AA Change: E140K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032066
Gene: ENSMUSG00000029999
AA Change: E140K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF 45 82 1.01e-1 SMART
transmembrane domain 98 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192058
SMART Domains Protein: ENSMUSP00000141395
Gene: ENSMUSG00000029999

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
PDB:4TGF|A 39 71 4e-17 PDB
SCOP:d1ioxa_ 42 71 8e-11 SMART
Blast:EGF 45 71 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194449
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of the epidermal growth factor (EGF) family of proteins that regulate cellular proliferation. The encoded protein undergoes proteolytic processing to generate a soluble glycoprotein that is secreted by the cell. The secreted protein binds to the EGF receptors to initiate signaling events resulting in cellular proliferation, mucous production or inhibition of gastric acid secretion. The transgenic expression of the encoded protein in mice induces the development of cancers in various tissues such as liver, pancreas, skin and mammary glands. Mice lacking the encoded protein exhibit a wavy coat and curly whiskers phenotype as well as abnormalities in the eye. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants have curly vibrissae, wavy hair with misaligned hair follicles, reduced body weight, and eye defects including open eyelids at birth, corneal scarring and microphthalmia. Some heterozygotes show mild forms of the eye abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Tgfa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03179:Tgfa APN 6 86271421 missense probably benign 0.01
R1109:Tgfa UTSW 6 86270090 intron probably benign
R5054:Tgfa UTSW 6 86270082 splice site probably null
R7602:Tgfa UTSW 6 86269962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTATGTGACTGACTTGTCCCC -3'
(R):5'- GCGATATTCTGTCAGGAGGACTGC -3'

Sequencing Primer
(F):5'- GGATCTGTCCAGGTCACCAATG -3'
(R):5'- CAGTCCAACCAGACTGGTG -3'
Posted On2013-09-30