Incidental Mutation 'R9369:Dnah7a'
ID 709173
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7a, Dnahc7, LOC381341
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R9369 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53397006-53706784 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 53504262 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 2250 (K2250E)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: K2250E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: K2250E

low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T G 17: 33,066,605 T408P probably damaging Het
9330159F19Rik T A 10: 29,224,978 V449D probably damaging Het
Abca13 G T 11: 9,378,444 V3506L probably damaging Het
Accs G A 2: 93,835,748 Q498* probably null Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
C2cd2 T C 16: 97,922,133 I61M possibly damaging Het
Cd22 T C 7: 30,877,574 T103A probably benign Het
Cd55 A T 1: 130,447,450 L150* probably null Het
Ces3b A G 8: 105,086,870 S258G probably damaging Het
Cln6 A G 9: 62,847,149 T158A probably damaging Het
Elmsan1 A G 12: 84,172,896 V428A probably benign Het
Emb G T 13: 117,220,560 probably benign Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ern1 A T 11: 106,414,433 M377K probably benign Het
Esrrb A G 12: 86,470,328 D78G probably damaging Het
Fat2 A T 11: 55,310,688 M520K possibly damaging Het
Foxb1 A G 9: 69,759,648 L200P probably damaging Het
Gli2 G T 1: 118,838,155 N755K probably benign Het
Gnal A G 18: 67,191,368 probably null Het
Gxylt1 A T 15: 93,275,015 F23I possibly damaging Het
Hsd17b13 T A 5: 103,977,168 R50W probably damaging Het
Htr5b G C 1: 121,527,753 A146G possibly damaging Het
Ifi206 A G 1: 173,473,923 F730L unknown Het
Ifrd2 C T 9: 107,590,603 Q163* probably null Het
Ift88 A T 14: 57,447,680 I318F probably benign Het
Ighv5-12 T A 12: 113,702,365 K38* probably null Het
Il17rc T C 6: 113,472,680 S112P probably benign Het
Itgb7 T C 15: 102,223,386 N254S probably damaging Het
Jak2 T A 19: 29,288,803 probably null Het
Jmjd8 A T 17: 25,829,712 H100L unknown Het
Kcnh4 T C 11: 100,757,602 E92G probably damaging Het
Kif13a T C 13: 46,786,623 I989V probably damaging Het
Kif5b A T 18: 6,223,584 N308K probably damaging Het
Loxl3 A T 6: 83,050,412 T683S probably benign Het
Macf1 C T 4: 123,455,357 probably null Het
Met A G 6: 17,492,229 K330R probably benign Het
Mybl1 T C 1: 9,672,604 E593G probably damaging Het
N4bp2 T G 5: 65,806,916 D769E probably damaging Het
Olfr1337 T A 4: 118,781,880 Q235L probably benign Het
Olfr1404 A G 1: 173,215,884 I78V possibly damaging Het
Olfr608 A G 7: 103,470,348 Y103C probably benign Het
Otoa C T 7: 121,145,617 A866V probably benign Het
Pak4 A G 7: 28,560,815 L492P probably damaging Het
Pctp A T 11: 89,986,112 L187H probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pik3ap1 T G 19: 41,329,304 D204A probably damaging Het
Pitrm1 T C 13: 6,553,244 V110A probably benign Het
Prokr1 A T 6: 87,581,425 V326E possibly damaging Het
Prrt2 T C 7: 127,020,171 I41V probably benign Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Ptpdc1 C T 13: 48,583,246 A683T possibly damaging Het
Ptprb A G 10: 116,315,152 K240E probably benign Het
Ranbp2 T C 10: 58,480,664 V2402A probably benign Het
Rictor T C 15: 6,744,367 F79L probably benign Het
Ripk2 A C 4: 16,127,651 S364A probably benign Het
S100a4 A T 3: 90,605,087 K26* probably null Het
Shank1 A G 7: 44,352,054 T1066A unknown Het
Slc9b2 A G 3: 135,330,685 T417A probably benign Het
Slf2 C T 19: 44,935,514 Q256* probably null Het
Smad5 T C 13: 56,737,429 V450A possibly damaging Het
Smok3c A C 5: 138,065,508 D419A probably damaging Het
Tdpoz4 A T 3: 93,796,434 T13S probably damaging Het
Tdrd6 A T 17: 43,625,326 N1610K probably damaging Het
Tex19.2 A G 11: 121,116,740 L294P possibly damaging Het
Tex44 T C 1: 86,427,661 W431R probably damaging Het
Tmcc1 A T 6: 116,134,089 V77E probably benign Het
Tmed4 A T 11: 6,274,133 M121K possibly damaging Het
Trit1 T C 4: 123,052,105 V349A possibly damaging Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ufd1 T C 16: 18,815,363 probably null Het
Umps T C 16: 33,956,836 N458S probably benign Het
Vmn2r24 A C 6: 123,815,398 Q561H probably damaging Het
Vwce T G 19: 10,646,697 S317R probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp977 A T 7: 42,580,094 F336I probably damaging Het
Zranb3 A T 1: 127,960,091 D866E probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53419684 missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53501542 missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53457746 missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01322:Dnah7a APN 1 53434046 missense probably benign 0.32
IGL01357:Dnah7a APN 1 53662381 missense probably benign
IGL01417:Dnah7a APN 1 53584600 missense probably benign 0.01
IGL01508:Dnah7a APN 1 53627072 missense probably benign 0.00
IGL01511:Dnah7a APN 1 53419595 missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53518782 missense probably benign
IGL01575:Dnah7a APN 1 53427820 splice site probably benign
IGL01667:Dnah7a APN 1 53547292 missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53423270 missense probably benign 0.23
IGL01824:Dnah7a APN 1 53504270 missense probably benign
IGL01829:Dnah7a APN 1 53618068 missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53640349 missense probably benign 0.01
IGL01861:Dnah7a APN 1 53584449 splice site probably benign
IGL01984:Dnah7a APN 1 53702015 splice site probably null
IGL02056:Dnah7a APN 1 53504342 missense probably benign 0.17
IGL02069:Dnah7a APN 1 53561894 splice site probably benign
IGL02072:Dnah7a APN 1 53605827 missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53411580 missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53495717 missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53437513 missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53623473 missense probably benign 0.01
IGL02151:Dnah7a APN 1 53472864 missense probably benign 0.08
IGL02156:Dnah7a APN 1 53419723 missense probably benign 0.27
IGL02270:Dnah7a APN 1 53472893 missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53643510 missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53524937 critical splice donor site probably null
IGL02370:Dnah7a APN 1 53635397 missense probably benign 0.00
IGL02420:Dnah7a APN 1 53686543 missense probably benign
IGL02458:Dnah7a APN 1 53618328 nonsense probably null
IGL02489:Dnah7a APN 1 53647322 missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53618046 missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53432915 missense probably benign 0.00
IGL02646:Dnah7a APN 1 53525035 missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53504024 missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53444472 missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53472959 splice site probably benign
IGL02874:Dnah7a APN 1 53605814 missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53522360 missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53577328 missense probably benign 0.27
IGL02926:Dnah7a APN 1 53495950 missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53433004 missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53605824 missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53419607 missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53686614 splice site probably benign
IGL03214:Dnah7a APN 1 53522209 critical splice donor site probably null
IGL03242:Dnah7a APN 1 53620723 missense probably benign 0.02
IGL03251:Dnah7a APN 1 53647274 missense probably benign
IGL03265:Dnah7a APN 1 53528848 missense probably benign
IGL03277:Dnah7a APN 1 53630322 missense probably benign 0.00
IGL03278:Dnah7a APN 1 53496965 missense probably benign 0.07
IGL03356:Dnah7a APN 1 53503934 missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53531203 missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53456874 splice site probably null
R0051:Dnah7a UTSW 1 53521086 splice site probably benign
R0082:Dnah7a UTSW 1 53518708 missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53468684 missense probably benign 0.03
R0122:Dnah7a UTSW 1 53397142 missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53501526 missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53504146 missense probably benign 0.00
R0309:Dnah7a UTSW 1 53405690 missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53433054 missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53504198 missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53605819 missense probably benign 0.00
R0511:Dnah7a UTSW 1 53497126 missense probably benign
R0576:Dnah7a UTSW 1 53636087 missense probably benign 0.12
R0592:Dnah7a UTSW 1 53456612 missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53497105 missense probably benign 0.18
R0689:Dnah7a UTSW 1 53620681 nonsense probably null
R0735:Dnah7a UTSW 1 53544511 missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53565696 missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53504079 missense probably benign 0.07
R0842:Dnah7a UTSW 1 53501674 missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53427860 missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53468669 missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53647236 splice site probably benign
R1421:Dnah7a UTSW 1 53540873 splice site probably benign
R1445:Dnah7a UTSW 1 53528797 missense probably benign 0.02
R1473:Dnah7a UTSW 1 53496014 missense probably benign 0.00
R1538:Dnah7a UTSW 1 53495989 missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53456684 missense probably benign 0.39
R1754:Dnah7a UTSW 1 53504185 missense probably benign 0.18
R1754:Dnah7a UTSW 1 53561900 critical splice donor site probably null
R1773:Dnah7a UTSW 1 53432887 splice site probably null
R1779:Dnah7a UTSW 1 53577223 missense probably benign
R1816:Dnah7a UTSW 1 53631742 splice site probably benign
R1817:Dnah7a UTSW 1 53559148 missense probably benign
R1818:Dnah7a UTSW 1 53559148 missense probably benign
R1819:Dnah7a UTSW 1 53559148 missense probably benign
R1873:Dnah7a UTSW 1 53456532 splice site probably benign
R1875:Dnah7a UTSW 1 53456532 splice site probably benign
R1884:Dnah7a UTSW 1 53541000 missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53535478 missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53631562 missense probably benign
R1959:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1960:Dnah7a UTSW 1 53684983 missense probably benign 0.00
R1985:Dnah7a UTSW 1 53503934 missense probably benign 0.01
R1992:Dnah7a UTSW 1 53582676 missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53582582 missense probably benign 0.00
R2074:Dnah7a UTSW 1 53457696 missense probably benign 0.45
R2076:Dnah7a UTSW 1 53503809 missense probably benign 0.01
R2124:Dnah7a UTSW 1 53496942 missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53605875 missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53479773 missense probably benign 0.21
R2220:Dnah7a UTSW 1 53521174 missense probably benign
R2355:Dnah7a UTSW 1 53582502 missense probably benign 0.00
R2495:Dnah7a UTSW 1 53605881 missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53427872 missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53427824 critical splice donor site probably null
R2993:Dnah7a UTSW 1 53503554 missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53618116 missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53444516 missense probably benign
R3723:Dnah7a UTSW 1 53447346 missense probably benign 0.04
R3847:Dnah7a UTSW 1 53501656 missense probably benign 0.01
R4002:Dnah7a UTSW 1 53631681 missense probably benign
R4009:Dnah7a UTSW 1 53525005 missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53425217 missense probably benign
R4193:Dnah7a UTSW 1 53447334 missense probably benign 0.00
R4236:Dnah7a UTSW 1 53447365 missense probably benign 0.00
R4399:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53444526 missense probably benign 0.01
R4494:Dnah7a UTSW 1 53449038 missense probably benign 0.01
R4569:Dnah7a UTSW 1 53411659 missense probably benign 0.01
R4609:Dnah7a UTSW 1 53456657 missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53427951 missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53447317 critical splice donor site probably null
R4781:Dnah7a UTSW 1 53425208 missense probably benign 0.28
R4854:Dnah7a UTSW 1 53706729 utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53503578 missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53698692 missense probably benign
R5000:Dnah7a UTSW 1 53567042 missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53647248 nonsense probably null
R5026:Dnah7a UTSW 1 53662498 missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53497096 missense probably benign 0.01
R5119:Dnah7a UTSW 1 53698692 missense probably benign
R5151:Dnah7a UTSW 1 53620770 missense probably benign 0.00
R5155:Dnah7a UTSW 1 53643495 missense probably benign 0.01
R5180:Dnah7a UTSW 1 53423287 missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53437609 critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53447531 splice site probably null
R5267:Dnah7a UTSW 1 53479692 missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53503646 missense probably benign 0.00
R5358:Dnah7a UTSW 1 53547172 missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53631653 missense probably benign 0.01
R5412:Dnah7a UTSW 1 53635344 missense probably benign
R5496:Dnah7a UTSW 1 53457768 missense probably benign
R5531:Dnah7a UTSW 1 53419748 missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53425253 missense probably benign
R5543:Dnah7a UTSW 1 53504069 missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53534452 missense probably benign 0.00
R5609:Dnah7a UTSW 1 53582594 missense probably benign 0.03
R5643:Dnah7a UTSW 1 53405707 missense probably benign
R5644:Dnah7a UTSW 1 53540979 missense probably benign 0.33
R5689:Dnah7a UTSW 1 53405698 missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53413778 missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53483319 missense probably benign 0.03
R5893:Dnah7a UTSW 1 53457785 missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53559308 missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53620670 missense probably benign 0.00
R6102:Dnah7a UTSW 1 53559140 missense probably benign 0.00
R6108:Dnah7a UTSW 1 53456845 missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53419655 missense probably benign 0.05
R6168:Dnah7a UTSW 1 53411568 missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53433022 missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53419636 missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53503601 missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53541114 missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53397190 missense probably benign 0.02
R6530:Dnah7a UTSW 1 53503697 missense probably benign 0.04
R6574:Dnah7a UTSW 1 53456534 critical splice donor site probably null
R6608:Dnah7a UTSW 1 53525118 missense probably benign
R6625:Dnah7a UTSW 1 53565757 missense probably benign 0.05
R6661:Dnah7a UTSW 1 53623450 missense probably benign 0.00
R6681:Dnah7a UTSW 1 53521226 critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53636062 missense probably benign 0.01
R6774:Dnah7a UTSW 1 53698651 missense probably benign
R6823:Dnah7a UTSW 1 53456704 missense probably benign
R6900:Dnah7a UTSW 1 53662351 missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53631677 missense probably benign 0.09
R6956:Dnah7a UTSW 1 53577287 missense probably benign 0.02
R6978:Dnah7a UTSW 1 53662367 missense probably null
R6988:Dnah7a UTSW 1 53582625 missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53504289 missense probably benign
R7027:Dnah7a UTSW 1 53631506 missense probably benign 0.01
R7033:Dnah7a UTSW 1 53479661 missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53419753 missense probably benign 0.00
R7096:Dnah7a UTSW 1 53483440 missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53413768 nonsense probably null
R7144:Dnah7a UTSW 1 53698708 splice site probably null
R7167:Dnah7a UTSW 1 53503776 missense probably benign 0.00
R7182:Dnah7a UTSW 1 53620461 splice site probably null
R7196:Dnah7a UTSW 1 53684841 missense probably benign 0.00
R7206:Dnah7a UTSW 1 53698633 nonsense probably null
R7215:Dnah7a UTSW 1 53618350 missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53397261 missense probably benign 0.00
R7264:Dnah7a UTSW 1 53518814 missense probably benign
R7282:Dnah7a UTSW 1 53684900 critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53497138 missense probably benign
R7392:Dnah7a UTSW 1 53501661 missense probably benign 0.00
R7454:Dnah7a UTSW 1 53518764 missense probably benign
R7471:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53663837 missense probably benign 0.00
R7554:Dnah7a UTSW 1 53528698 missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53496005 missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53547297 missense probably benign 0.00
R7721:Dnah7a UTSW 1 53631683 missense probably benign
R7813:Dnah7a UTSW 1 53618086 missense probably benign
R7839:Dnah7a UTSW 1 53567175 missense probably benign 0.08
R7959:Dnah7a UTSW 1 53643462 missense probably benign 0.00
R7984:Dnah7a UTSW 1 53504218 missense probably benign 0.01
R7985:Dnah7a UTSW 1 53518727 missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53503890 missense probably benign
R8140:Dnah7a UTSW 1 53501589 missense probably benign 0.02
R8184:Dnah7a UTSW 1 53627035 missense probably benign 0.03
R8339:Dnah7a UTSW 1 53685019 missense probably benign
R8352:Dnah7a UTSW 1 53427827 missense probably null 0.01
R8423:Dnah7a UTSW 1 53472904 missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53472953 missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53618036 missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53427827 missense probably null 0.01
R8458:Dnah7a UTSW 1 53617983 missense probably benign 0.01
R8493:Dnah7a UTSW 1 53472908 missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53617980 missense probably benign 0.01
R8502:Dnah7a UTSW 1 53640361 missense probably benign 0.39
R8692:Dnah7a UTSW 1 53433016 missense probably benign 0.00
R8700:Dnah7a UTSW 1 53495929 missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53635317 missense probably benign
R8856:Dnah7a UTSW 1 53423263 missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53643523 missense probably benign 0.10
R8967:Dnah7a UTSW 1 53643435 splice site probably benign
R8982:Dnah7a UTSW 1 53531142 missense probably benign
R8984:Dnah7a UTSW 1 53635277 nonsense probably null
R8993:Dnah7a UTSW 1 53504103 missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53662342 missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53472957 critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53521138 missense probably benign 0.00
R9077:Dnah7a UTSW 1 53702059 missense unknown
R9167:Dnah7a UTSW 1 53618211 missense probably benign 0.00
R9206:Dnah7a UTSW 1 53501598 missense probably benign 0.11
R9226:Dnah7a UTSW 1 53521167 missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53582512 missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53635346 missense probably benign
R9350:Dnah7a UTSW 1 53397148 missense probably benign 0.19
R9369:Dnah7a UTSW 1 53525063 missense possibly damaging 0.72
R9372:Dnah7a UTSW 1 53504315 missense probably benign
R9376:Dnah7a UTSW 1 53528899 critical splice acceptor site probably null
R9378:Dnah7a UTSW 1 53582617 missense probably benign 0.32
R9401:Dnah7a UTSW 1 53528867 missense probably benign 0.01
R9431:Dnah7a UTSW 1 53411653 missense possibly damaging 0.90
X0027:Dnah7a UTSW 1 53472930 missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53468643 missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53419699 missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53483463 missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53411656 missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53559102 missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53643457 missense possibly damaging 0.92
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2022-04-18