Mutagenetix > Incidental Mutation

Incidental Mutation 'R0745:Mug1'

70918

Institutional Source

Beutler Lab

Gene Symbol

Mug1

Ensembl Gene

ENSMUSG00000059908

Gene Name

murinoglobulin 1

Synonyms

MMRRC Submission

038926-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121838541-121889057 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121887427 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1428 (T1428A)

Ref Sequence

ENSEMBL: ENSMUSP00000032228 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032228]

AlphaFold

P28665

Predicted Effect

probably benign
Transcript: ENSMUST00000032228
AA Change: T1428A

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000032228
Gene: ENSMUSG00000059908
AA Change: T1428A

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:A2M_N	128	221	5e-21	PFAM
A2M_N_2	449	599	2.55e-41	SMART
A2M	740	830	5.43e-36	SMART
Pfam:Thiol-ester_cl	963	992	1e-18	PFAM
Pfam:A2M_comp	1012	1268	5.4e-94	PFAM
A2M_recep	1378	1465	4.14e-41	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204210

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 95.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and phenotypically normal under standard conditions but show increased mortality in response to diet-induced acute pancreatitis along with hepatic cell necrosis and inflammatory infiltration, andincreased plasma amylase and lipase levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,928,463	Y759C	probably damaging	Het
Abhd12	A	T	2: 150,833,148		probably null	Het
Adam17	A	G	12: 21,332,221		probably benign	Het
Aldh1l2	T	A	10: 83,518,630		probably null	Het
Brca2	A	T	5: 150,544,882		probably benign	Het
Capn13	A	C	17: 73,351,508	D188E	probably benign	Het
Col14a1	A	T	15: 55,338,417	T34S	unknown	Het
Col5a2	A	G	1: 45,407,227		probably null	Het
Cyp4v3	A	G	8: 45,308,651		probably benign	Het
Dlat	G	A	9: 50,653,708	T233M	probably damaging	Het
Eef2	C	T	10: 81,181,996	P831S	probably benign	Het
Endod1	A	T	9: 14,357,117	N357K	possibly damaging	Het
Evc	A	T	5: 37,319,059	V205E	probably damaging	Het
Fryl	A	G	5: 73,071,126	L1754P	probably damaging	Het
Gabra6	A	T	11: 42,316,567	M230K	probably damaging	Het
Hsd3b5	A	G	3: 98,619,539	V197A	probably benign	Het
Kmt2c	A	T	5: 25,359,698		probably null	Het
Mthfsd	A	T	8: 121,102,949	L116Q	probably damaging	Het
Obscn	A	G	11: 59,082,239	V2312A	probably benign	Het
Olfr1357	T	C	10: 78,612,122	E173G	probably benign	Het
Palld	G	A	8: 61,877,703	R47C	probably damaging	Het
Pds5b	A	G	5: 150,805,671	T1424A	probably benign	Het
Ppp6r2	G	A	15: 89,265,242		probably null	Het
Sik3	A	G	9: 46,198,239	N505S	probably benign	Het
Spin1	A	G	13: 51,139,515	Y87C	probably damaging	Het
Tcp11	T	C	17: 28,067,160	I494V	possibly damaging	Het
Tgfa	G	A	6: 86,271,435	E140K	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trmo	A	G	4: 46,382,104	F338L	probably damaging	Het
Tspan17	T	C	13: 54,789,674	V27A	possibly damaging	Het
Uba5	A	G	9: 104,049,511		probably benign	Het
Unc5a	CTGTGTGTGTGTGTGT	CTGTGTGTGTGTGT	13: 55,005,255		probably null	Het
Zbbx	C	T	3: 75,155,427	V8I	probably damaging	Het
Zcchc11	C	G	4: 108,502,955		probably benign	Het
Zfp451	A	T	1: 33,770,848	L931*	probably null	Het
Zmym4	A	T	4: 126,902,703		probably benign	Het

Other mutations in Mug1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Mug1	APN	6	121865809	missense	probably damaging	1.00
IGL00485:Mug1	APN	6	121887416	missense	probably benign	0.17
IGL00816:Mug1	APN	6	121882638	missense	probably damaging	0.99
IGL01140:Mug1	APN	6	121882734	missense	probably benign	0.01
IGL01141:Mug1	APN	6	121870499	missense	probably benign	0.08
IGL01384:Mug1	APN	6	121849474	splice site	probably benign
IGL01659:Mug1	APN	6	121870660	splice site	probably benign
IGL02049:Mug1	APN	6	121871336	missense	probably benign
IGL02151:Mug1	APN	6	121884690	critical splice donor site	probably null
IGL02315:Mug1	APN	6	121840167	missense	probably benign
IGL02629:Mug1	APN	6	121840065	missense	possibly damaging	0.62
IGL02642:Mug1	APN	6	121882585	missense	probably benign	0.14
IGL02807:Mug1	APN	6	121886572	missense	probably damaging	0.96
IGL02932:Mug1	APN	6	121887427	missense	probably benign	0.35
IGL03232:Mug1	APN	6	121878535	missense	probably benign	0.00
R1462_Mug1_304	UTSW	6	121882629	missense	probably benign	0.41
R2341_Mug1_749	UTSW	6	121884629	missense	probably benign	0.06
R4261_Mug1_652	UTSW	6	121873734	missense	probably benign
R6173_mug1_139	UTSW	6	121863793	missense	probably damaging	0.99
IGL03050:Mug1	UTSW	6	121880571	missense	possibly damaging	0.90
R0101:Mug1	UTSW	6	121884247	missense	possibly damaging	0.59
R0194:Mug1	UTSW	6	121840107	missense	probably damaging	0.98
R0196:Mug1	UTSW	6	121838725	critical splice donor site	probably null
R0325:Mug1	UTSW	6	121849842	missense	probably benign
R0332:Mug1	UTSW	6	121849897	splice site	probably null
R0377:Mug1	UTSW	6	121857361	missense	probably benign	0.02
R0393:Mug1	UTSW	6	121849850	missense	possibly damaging	0.64
R0414:Mug1	UTSW	6	121856554	missense	probably benign	0.00
R0457:Mug1	UTSW	6	121861555	missense	probably benign	0.06
R0479:Mug1	UTSW	6	121840227	missense	probably benign
R0519:Mug1	UTSW	6	121851424	missense	possibly damaging	0.83
R0535:Mug1	UTSW	6	121851454	missense	probably benign
R0939:Mug1	UTSW	6	121884349	missense	possibly damaging	0.95
R0975:Mug1	UTSW	6	121878539	missense	probably damaging	0.99
R1033:Mug1	UTSW	6	121880551	missense	probably damaging	0.99
R1086:Mug1	UTSW	6	121885854	missense	probably damaging	1.00
R1116:Mug1	UTSW	6	121870645	missense	probably benign
R1131:Mug1	UTSW	6	121861185	missense	probably benign	0.18
R1249:Mug1	UTSW	6	121849461	missense	probably benign	0.07
R1364:Mug1	UTSW	6	121881713	missense	probably damaging	1.00
R1418:Mug1	UTSW	6	121838676	missense	probably benign	0.00
R1462:Mug1	UTSW	6	121882629	missense	probably benign	0.41
R1462:Mug1	UTSW	6	121882629	missense	probably benign	0.41
R1494:Mug1	UTSW	6	121879300	missense	probably damaging	1.00
R1639:Mug1	UTSW	6	121880571	missense	probably damaging	1.00
R1901:Mug1	UTSW	6	121881821	missense	probably benign
R1902:Mug1	UTSW	6	121881821	missense	probably benign
R2087:Mug1	UTSW	6	121856291	missense	probably benign	0.00
R2168:Mug1	UTSW	6	121870499	missense	probably benign	0.08
R2249:Mug1	UTSW	6	121870510	missense	probably benign
R2341:Mug1	UTSW	6	121884629	missense	probably benign	0.06
R2888:Mug1	UTSW	6	121881843	missense	probably benign	0.44
R2892:Mug1	UTSW	6	121840070	missense	possibly damaging	0.91
R3703:Mug1	UTSW	6	121888556	splice site	probably benign
R3789:Mug1	UTSW	6	121884628	missense	probably benign	0.03
R3790:Mug1	UTSW	6	121884628	missense	probably benign	0.03
R3950:Mug1	UTSW	6	121878530	missense	probably damaging	1.00
R4261:Mug1	UTSW	6	121873734	missense	probably benign
R4402:Mug1	UTSW	6	121879352	missense	probably damaging	1.00
R4589:Mug1	UTSW	6	121857351	missense	probably benign	0.19
R4707:Mug1	UTSW	6	121884641	missense	probably damaging	1.00
R4766:Mug1	UTSW	6	121884254	missense	probably benign	0.01
R4840:Mug1	UTSW	6	121885854	missense	probably damaging	1.00
R4984:Mug1	UTSW	6	121838617	utr 5 prime	probably benign
R4999:Mug1	UTSW	6	121878943	nonsense	probably null
R5198:Mug1	UTSW	6	121874562	missense	probably damaging	1.00
R5220:Mug1	UTSW	6	121861133	missense	probably benign	0.03
R5253:Mug1	UTSW	6	121888913	missense	probably benign	0.03
R5273:Mug1	UTSW	6	121873789	missense	probably damaging	0.99
R5285:Mug1	UTSW	6	121841107	missense	probably benign	0.45
R5387:Mug1	UTSW	6	121884394	missense	probably damaging	0.99
R5560:Mug1	UTSW	6	121861073	missense	probably damaging	0.96
R5652:Mug1	UTSW	6	121840181	missense	probably benign
R5704:Mug1	UTSW	6	121851433	missense	possibly damaging	0.63
R5732:Mug1	UTSW	6	121878493	missense	probably benign	0.00
R6053:Mug1	UTSW	6	121865738	missense	probably benign	0.00
R6173:Mug1	UTSW	6	121863793	missense	probably damaging	0.99
R6578:Mug1	UTSW	6	121887452	missense	probably benign	0.00
R6647:Mug1	UTSW	6	121840241	missense	probably benign	0.02
R6681:Mug1	UTSW	6	121838724	missense	possibly damaging	0.75
R6925:Mug1	UTSW	6	121881787	missense	probably damaging	1.00
R7014:Mug1	UTSW	6	121861125	missense	probably benign	0.22
R7031:Mug1	UTSW	6	121838714	missense	probably benign	0.00
R7034:Mug1	UTSW	6	121873644	missense	probably benign	0.00
R7156:Mug1	UTSW	6	121880905	missense	probably damaging	1.00
R7156:Mug1	UTSW	6	121884343	missense	probably damaging	1.00
R7179:Mug1	UTSW	6	121857420	missense	probably benign	0.00
R7211:Mug1	UTSW	6	121880539	missense	possibly damaging	0.52
R7318:Mug1	UTSW	6	121870652	critical splice donor site	probably null
R7462:Mug1	UTSW	6	121875440	missense	probably benign	0.00
R7479:Mug1	UTSW	6	121878508	missense	possibly damaging	0.83
R7588:Mug1	UTSW	6	121875517	missense	probably damaging	1.00
R7611:Mug1	UTSW	6	121875428	critical splice acceptor site	probably null
R7659:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7660:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7661:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7663:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7664:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7666:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7788:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7789:Mug1	UTSW	6	121861220	missense	possibly damaging	0.95
R7794:Mug1	UTSW	6	121856288	missense	possibly damaging	0.93
R7809:Mug1	UTSW	6	121878985	missense	possibly damaging	0.79
R7836:Mug1	UTSW	6	121870652	critical splice donor site	probably null
R7867:Mug1	UTSW	6	121873634	missense	probably benign
R7904:Mug1	UTSW	6	121851465	missense	probably benign
R7937:Mug1	UTSW	6	121861169	missense	probably benign	0.00
R7981:Mug1	UTSW	6	121881764	missense	probably damaging	1.00
R7999:Mug1	UTSW	6	121880896	missense	possibly damaging	0.90
R8070:Mug1	UTSW	6	121875879	missense	probably benign	0.26
R8071:Mug1	UTSW	6	121873672	missense	probably benign
R8151:Mug1	UTSW	6	121841158	missense	probably benign	0.01
R8491:Mug1	UTSW	6	121882729	missense	probably damaging	1.00
R8714:Mug1	UTSW	6	121882722	missense	probably benign	0.01
R8734:Mug1	UTSW	6	121871381	missense	probably benign	0.00
R8738:Mug1	UTSW	6	121840249	splice site	probably benign
R8807:Mug1	UTSW	6	121874475	missense	probably benign	0.27
R8931:Mug1	UTSW	6	121884337	missense	probably benign
R8940:Mug1	UTSW	6	121881683	missense
R9156:Mug1	UTSW	6	121874431	missense	probably damaging	0.99
R9314:Mug1	UTSW	6	121857337	missense	probably damaging	0.97
R9315:Mug1	UTSW	6	121873771	missense	possibly damaging	0.95
R9330:Mug1	UTSW	6	121882764	missense	probably benign	0.14
R9334:Mug1	UTSW	6	121861531	missense	probably benign	0.01
R9357:Mug1	UTSW	6	121875491	missense	probably benign	0.02
R9515:Mug1	UTSW	6	121884676	missense	probably damaging	1.00
R9549:Mug1	UTSW	6	121881803	missense	probably damaging	1.00
R9564:Mug1	UTSW	6	121884628	missense	probably benign	0.03
R9663:Mug1	UTSW	6	121880504	missense	probably benign	0.08
R9663:Mug1	UTSW	6	121882740	missense	probably benign	0.03
R9681:Mug1	UTSW	6	121856295	missense	probably benign	0.01
R9777:Mug1	UTSW	6	121880905	missense	probably damaging	1.00
RF017:Mug1	UTSW	6	121884574	missense	probably damaging	1.00
X0064:Mug1	UTSW	6	121861215	missense	possibly damaging	0.48
Z1176:Mug1	UTSW	6	121841294	missense	probably benign	0.32
Z1176:Mug1	UTSW	6	121880493	missense	probably damaging	1.00
Z1177:Mug1	UTSW	6	121863808	missense	probably damaging	0.99
Z1177:Mug1	UTSW	6	121879299	critical splice acceptor site	probably null
Z1177:Mug1	UTSW	6	121886568	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGTTTCCCCAGCCACCAGTTTG -3'
(R):5'- TGATCCCACATGGTTGCTTGGAC -3'

Sequencing Primer
(F):5'- GCCACCAGTTTGAAATCCATATC -3'
(R):5'- gcatttgggacactgaatatagagg -3'

Posted On

2013-09-30