Incidental Mutation 'R9369:Smok3c'
ID 709195
Institutional Source Beutler Lab
Gene Symbol Smok3c
Ensembl Gene ENSMUSG00000075598
Gene Name sperm motility kinase 3C
Synonyms EG622486
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock # R9369 (G1)
Quality Score 192.009
Status Not validated
Chromosome 5
Chromosomal Location 138053194-138066537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 138065508 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 419 (D419A)
Ref Sequence ENSEMBL: ENSMUSP00000141020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110967] [ENSMUST00000178402]
AlphaFold A0A087WSF2
Predicted Effect probably damaging
Transcript: ENSMUST00000110967
AA Change: D419A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141020
Gene: ENSMUSG00000075598
AA Change: D419A

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178402
AA Change: D419A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140749
Gene: ENSMUSG00000075598
AA Change: D419A

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
4921501E09Rik T G 17: 33,066,605 T408P probably damaging Het
9330159F19Rik T A 10: 29,224,978 V449D probably damaging Het
Abca13 G T 11: 9,378,444 V3506L probably damaging Het
Accs G A 2: 93,835,748 Q498* probably null Het
Ankrd17 C T 5: 90,268,649 R1108Q probably damaging Het
C2cd2 T C 16: 97,922,133 I61M possibly damaging Het
Cd22 T C 7: 30,877,574 T103A probably benign Het
Cd55 A T 1: 130,447,450 L150* probably null Het
Ces3b A G 8: 105,086,870 S258G probably damaging Het
Cln6 A G 9: 62,847,149 T158A probably damaging Het
Dnah7a T C 1: 53,504,262 K2250E probably benign Het
Dnah7a T A 1: 53,525,063 N1946Y possibly damaging Het
Elmsan1 A G 12: 84,172,896 V428A probably benign Het
Emb G T 13: 117,220,560 probably benign Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ern1 A T 11: 106,414,433 M377K probably benign Het
Esrrb A G 12: 86,470,328 D78G probably damaging Het
Fat2 A T 11: 55,310,688 M520K possibly damaging Het
Foxb1 A G 9: 69,759,648 L200P probably damaging Het
Gli2 G T 1: 118,838,155 N755K probably benign Het
Gnal A G 18: 67,191,368 probably null Het
Gxylt1 A T 15: 93,275,015 F23I possibly damaging Het
Hsd17b13 T A 5: 103,977,168 R50W probably damaging Het
Htr5b G C 1: 121,527,753 A146G possibly damaging Het
Ifi206 A G 1: 173,473,923 F730L unknown Het
Ifrd2 C T 9: 107,590,603 Q163* probably null Het
Ift88 A T 14: 57,447,680 I318F probably benign Het
Ighv5-12 T A 12: 113,702,365 K38* probably null Het
Il17rc T C 6: 113,472,680 S112P probably benign Het
Itgb7 T C 15: 102,223,386 N254S probably damaging Het
Jak2 T A 19: 29,288,803 probably null Het
Jmjd8 A T 17: 25,829,712 H100L unknown Het
Kcnh4 T C 11: 100,757,602 E92G probably damaging Het
Kif13a T C 13: 46,786,623 I989V probably damaging Het
Kif5b A T 18: 6,223,584 N308K probably damaging Het
Loxl3 A T 6: 83,050,412 T683S probably benign Het
Macf1 C T 4: 123,455,357 probably null Het
Met A G 6: 17,492,229 K330R probably benign Het
Mybl1 T C 1: 9,672,604 E593G probably damaging Het
N4bp2 T G 5: 65,806,916 D769E probably damaging Het
Olfr1337 T A 4: 118,781,880 Q235L probably benign Het
Olfr1404 A G 1: 173,215,884 I78V possibly damaging Het
Olfr608 A G 7: 103,470,348 Y103C probably benign Het
Otoa C T 7: 121,145,617 A866V probably benign Het
Pak4 A G 7: 28,560,815 L492P probably damaging Het
Pctp A T 11: 89,986,112 L187H probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pik3ap1 T G 19: 41,329,304 D204A probably damaging Het
Pitrm1 T C 13: 6,553,244 V110A probably benign Het
Prokr1 A T 6: 87,581,425 V326E possibly damaging Het
Prrt2 T C 7: 127,020,171 I41V probably benign Het
Psmb1 A G 17: 15,490,216 Y24H probably damaging Het
Ptpdc1 C T 13: 48,583,246 A683T possibly damaging Het
Ptprb A G 10: 116,315,152 K240E probably benign Het
Ranbp2 T C 10: 58,480,664 V2402A probably benign Het
Rictor T C 15: 6,744,367 F79L probably benign Het
Ripk2 A C 4: 16,127,651 S364A probably benign Het
S100a4 A T 3: 90,605,087 K26* probably null Het
Shank1 A G 7: 44,352,054 T1066A unknown Het
Slc9b2 A G 3: 135,330,685 T417A probably benign Het
Slf2 C T 19: 44,935,514 Q256* probably null Het
Smad5 T C 13: 56,737,429 V450A possibly damaging Het
Tdpoz4 A T 3: 93,796,434 T13S probably damaging Het
Tdrd6 A T 17: 43,625,326 N1610K probably damaging Het
Tex19.2 A G 11: 121,116,740 L294P possibly damaging Het
Tex44 T C 1: 86,427,661 W431R probably damaging Het
Tmcc1 A T 6: 116,134,089 V77E probably benign Het
Tmed4 A T 11: 6,274,133 M121K possibly damaging Het
Trit1 T C 4: 123,052,105 V349A possibly damaging Het
Txndc15 C T 13: 55,721,694 A220V probably benign Het
Tyw1 G A 5: 130,269,224 R202Q probably damaging Het
Ufd1 T C 16: 18,815,363 probably null Het
Umps T C 16: 33,956,836 N458S probably benign Het
Vmn2r24 A C 6: 123,815,398 Q561H probably damaging Het
Vwce T G 19: 10,646,697 S317R probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp977 A T 7: 42,580,094 F336I probably damaging Het
Zranb3 A T 1: 127,960,091 D866E probably benign Het
Other mutations in Smok3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4440:Smok3c UTSW 5 138064604 missense possibly damaging 0.93
R4560:Smok3c UTSW 5 138064484 missense probably benign 0.42
R4900:Smok3c UTSW 5 138064551 missense probably damaging 1.00
R4924:Smok3c UTSW 5 138065582 nonsense probably null
R5292:Smok3c UTSW 5 138065184 missense probably damaging 1.00
R5446:Smok3c UTSW 5 138064633 missense probably damaging 1.00
R6111:Smok3c UTSW 5 138065103 missense probably damaging 0.98
R6154:Smok3c UTSW 5 138064485 missense probably benign 0.04
R6225:Smok3c UTSW 5 138065052 missense probably benign 0.15
R6759:Smok3c UTSW 5 138065437 missense probably benign 0.04
R6979:Smok3c UTSW 5 138064725 missense probably benign 0.12
R7127:Smok3c UTSW 5 138064709 missense probably damaging 0.96
R7260:Smok3c UTSW 5 138065623 missense possibly damaging 0.84
R7445:Smok3c UTSW 5 138064495 missense probably damaging 1.00
R7962:Smok3c UTSW 5 138065079 missense probably damaging 0.98
R8160:Smok3c UTSW 5 138065024 missense possibly damaging 0.91
R8223:Smok3c UTSW 5 138065393 missense probably benign 0.00
R8381:Smok3c UTSW 5 138065562 missense probably benign
R8841:Smok3c UTSW 5 138065275 missense probably damaging 0.99
R9166:Smok3c UTSW 5 138065519 missense possibly damaging 0.61
Z1177:Smok3c UTSW 5 138064602 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACTACCTGTCTCGGAC -3'
(R):5'- CCCAGGTGAGATGTCTCTTTGG -3'

Sequencing Primer
(F):5'- TCTCGGACTTCGCAGGAGAG -3'
(R):5'- CTCTTTGGATGGGATACAGCAAC -3'
Posted On 2022-04-18