Incidental Mutation 'R9369:Smok3c'
ID 709195
Institutional Source Beutler Lab
Gene Symbol Smok3c
Ensembl Gene ENSMUSG00000075598
Gene Name sperm motility kinase 3C
Synonyms EG622486
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.700) question?
Stock # R9369 (G1)
Quality Score 192.009
Status Not validated
Chromosome 5
Chromosomal Location 138051456-138064799 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 138063770 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 419 (D419A)
Ref Sequence ENSEMBL: ENSMUSP00000141020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110967] [ENSMUST00000178402]
AlphaFold A0A087WSF2
Predicted Effect probably damaging
Transcript: ENSMUST00000110967
AA Change: D419A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141020
Gene: ENSMUSG00000075598
AA Change: D419A

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178402
AA Change: D419A

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140749
Gene: ENSMUSG00000075598
AA Change: D419A

DomainStartEndE-ValueType
S_TKc 28 276 2.88e-97 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
9330159F19Rik T A 10: 29,100,974 (GRCm39) V449D probably damaging Het
Abca13 G T 11: 9,328,444 (GRCm39) V3506L probably damaging Het
Accs G A 2: 93,666,093 (GRCm39) Q498* probably null Het
Ankrd17 C T 5: 90,416,508 (GRCm39) R1108Q probably damaging Het
C2cd2 T C 16: 97,723,333 (GRCm39) I61M possibly damaging Het
Cd22 T C 7: 30,576,999 (GRCm39) T103A probably benign Het
Cd55 A T 1: 130,375,187 (GRCm39) L150* probably null Het
Ces3b A G 8: 105,813,502 (GRCm39) S258G probably damaging Het
Cln6 A G 9: 62,754,431 (GRCm39) T158A probably damaging Het
Dnah7a T C 1: 53,543,421 (GRCm39) K2250E probably benign Het
Dnah7a T A 1: 53,564,222 (GRCm39) N1946Y possibly damaging Het
Emb G T 13: 117,357,096 (GRCm39) probably benign Het
Eps15 T A 4: 109,240,034 (GRCm39) D492E probably damaging Het
Ern1 A T 11: 106,305,259 (GRCm39) M377K probably benign Het
Esrrb A G 12: 86,517,102 (GRCm39) D78G probably damaging Het
Fat2 A T 11: 55,201,514 (GRCm39) M520K possibly damaging Het
Foxb1 A G 9: 69,666,930 (GRCm39) L200P probably damaging Het
Gli2 G T 1: 118,765,885 (GRCm39) N755K probably benign Het
Gnal A G 18: 67,324,439 (GRCm39) probably null Het
Gxylt1 A T 15: 93,172,896 (GRCm39) F23I possibly damaging Het
Hsd17b13 T A 5: 104,125,034 (GRCm39) R50W probably damaging Het
Htr5b G C 1: 121,455,482 (GRCm39) A146G possibly damaging Het
Ifi206 A G 1: 173,301,489 (GRCm39) F730L unknown Het
Ifrd2 C T 9: 107,467,802 (GRCm39) Q163* probably null Het
Ift88 A T 14: 57,685,137 (GRCm39) I318F probably benign Het
Ighv5-12 T A 12: 113,665,985 (GRCm39) K38* probably null Het
Il17rc T C 6: 113,449,641 (GRCm39) S112P probably benign Het
Itgb7 T C 15: 102,131,821 (GRCm39) N254S probably damaging Het
Jak2 T A 19: 29,266,203 (GRCm39) probably null Het
Jmjd8 A T 17: 26,048,686 (GRCm39) H100L unknown Het
Kcnh4 T C 11: 100,648,428 (GRCm39) E92G probably damaging Het
Kif13a T C 13: 46,940,099 (GRCm39) I989V probably damaging Het
Kif5b A T 18: 6,223,584 (GRCm39) N308K probably damaging Het
Loxl3 A T 6: 83,027,393 (GRCm39) T683S probably benign Het
Macf1 C T 4: 123,349,150 (GRCm39) probably null Het
Met A G 6: 17,492,228 (GRCm39) K330R probably benign Het
Mideas A G 12: 84,219,670 (GRCm39) V428A probably benign Het
Mybl1 T C 1: 9,742,829 (GRCm39) E593G probably damaging Het
N4bp2 T G 5: 65,964,259 (GRCm39) D769E probably damaging Het
Or10ak13 T A 4: 118,639,077 (GRCm39) Q235L probably benign Het
Or10j3b A G 1: 173,043,451 (GRCm39) I78V possibly damaging Het
Or52ae7 A G 7: 103,119,555 (GRCm39) Y103C probably benign Het
Otoa C T 7: 120,744,840 (GRCm39) A866V probably benign Het
Pak4 A G 7: 28,260,240 (GRCm39) L492P probably damaging Het
Pctp A T 11: 89,876,938 (GRCm39) L187H probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Phf8-ps T G 17: 33,285,579 (GRCm39) T408P probably damaging Het
Pik3ap1 T G 19: 41,317,743 (GRCm39) D204A probably damaging Het
Pitrm1 T C 13: 6,603,280 (GRCm39) V110A probably benign Het
Prokr1 A T 6: 87,558,407 (GRCm39) V326E possibly damaging Het
Prrt2 T C 7: 126,619,343 (GRCm39) I41V probably benign Het
Psmb1 A G 17: 15,710,478 (GRCm39) Y24H probably damaging Het
Ptpdc1 C T 13: 48,736,722 (GRCm39) A683T possibly damaging Het
Ptprb A G 10: 116,151,057 (GRCm39) K240E probably benign Het
Ranbp2 T C 10: 58,316,486 (GRCm39) V2402A probably benign Het
Rictor T C 15: 6,773,848 (GRCm39) F79L probably benign Het
Ripk2 A C 4: 16,127,651 (GRCm39) S364A probably benign Het
S100a4 A T 3: 90,512,394 (GRCm39) K26* probably null Het
Shank1 A G 7: 44,001,478 (GRCm39) T1066A unknown Het
Slc9b2 A G 3: 135,036,446 (GRCm39) T417A probably benign Het
Slf2 C T 19: 44,923,953 (GRCm39) Q256* probably null Het
Smad5 T C 13: 56,885,242 (GRCm39) V450A possibly damaging Het
Tdpoz4 A T 3: 93,703,741 (GRCm39) T13S probably damaging Het
Tdrd6 A T 17: 43,936,217 (GRCm39) N1610K probably damaging Het
Tex19.2 A G 11: 121,007,566 (GRCm39) L294P possibly damaging Het
Tex44 T C 1: 86,355,383 (GRCm39) W431R probably damaging Het
Tmcc1 A T 6: 116,111,050 (GRCm39) V77E probably benign Het
Tmed4 A T 11: 6,224,133 (GRCm39) M121K possibly damaging Het
Trit1 T C 4: 122,945,898 (GRCm39) V349A possibly damaging Het
Txndc15 C T 13: 55,869,507 (GRCm39) A220V probably benign Het
Tyw1 G A 5: 130,298,065 (GRCm39) R202Q probably damaging Het
Ufd1 T C 16: 18,634,113 (GRCm39) probably null Het
Umps T C 16: 33,777,206 (GRCm39) N458S probably benign Het
Vmn2r24 A C 6: 123,792,357 (GRCm39) Q561H probably damaging Het
Vwce T G 19: 10,624,061 (GRCm39) S317R probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp977 A T 7: 42,229,518 (GRCm39) F336I probably damaging Het
Zranb3 A T 1: 127,887,828 (GRCm39) D866E probably benign Het
Other mutations in Smok3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4440:Smok3c UTSW 5 138,062,866 (GRCm39) missense possibly damaging 0.93
R4560:Smok3c UTSW 5 138,062,746 (GRCm39) missense probably benign 0.42
R4900:Smok3c UTSW 5 138,062,813 (GRCm39) missense probably damaging 1.00
R4924:Smok3c UTSW 5 138,063,844 (GRCm39) nonsense probably null
R5292:Smok3c UTSW 5 138,063,446 (GRCm39) missense probably damaging 1.00
R5446:Smok3c UTSW 5 138,062,895 (GRCm39) missense probably damaging 1.00
R6111:Smok3c UTSW 5 138,063,365 (GRCm39) missense probably damaging 0.98
R6154:Smok3c UTSW 5 138,062,747 (GRCm39) missense probably benign 0.04
R6225:Smok3c UTSW 5 138,063,314 (GRCm39) missense probably benign 0.15
R6759:Smok3c UTSW 5 138,063,699 (GRCm39) missense probably benign 0.04
R6979:Smok3c UTSW 5 138,062,987 (GRCm39) missense probably benign 0.12
R7127:Smok3c UTSW 5 138,062,971 (GRCm39) missense probably damaging 0.96
R7260:Smok3c UTSW 5 138,063,885 (GRCm39) missense possibly damaging 0.84
R7445:Smok3c UTSW 5 138,062,757 (GRCm39) missense probably damaging 1.00
R7962:Smok3c UTSW 5 138,063,341 (GRCm39) missense probably damaging 0.98
R8160:Smok3c UTSW 5 138,063,286 (GRCm39) missense possibly damaging 0.91
R8223:Smok3c UTSW 5 138,063,655 (GRCm39) missense probably benign 0.00
R8381:Smok3c UTSW 5 138,063,824 (GRCm39) missense probably benign
R8841:Smok3c UTSW 5 138,063,537 (GRCm39) missense probably damaging 0.99
R9166:Smok3c UTSW 5 138,063,781 (GRCm39) missense possibly damaging 0.61
Z1177:Smok3c UTSW 5 138,062,864 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTACTACCTGTCTCGGAC -3'
(R):5'- CCCAGGTGAGATGTCTCTTTGG -3'

Sequencing Primer
(F):5'- TCTCGGACTTCGCAGGAGAG -3'
(R):5'- CTCTTTGGATGGGATACAGCAAC -3'
Posted On 2022-04-18