Incidental Mutation 'R0745:Mthfsd'
ID70921
Institutional Source Beutler Lab
Gene Symbol Mthfsd
Ensembl Gene ENSMUSG00000031816
Gene Namemethenyltetrahydrofolate synthetase domain containing
Synonyms
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121091628-121108392 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121102949 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 116 (L116Q)
Ref Sequence ENSEMBL: ENSMUSP00000115382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047282] [ENSMUST00000116415] [ENSMUST00000126431] [ENSMUST00000127664] [ENSMUST00000128052] [ENSMUST00000133037] [ENSMUST00000134758] [ENSMUST00000139782] [ENSMUST00000151576]
Predicted Effect probably damaging
Transcript: ENSMUST00000047282
AA Change: L116Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044172
Gene: ENSMUSG00000031816
AA Change: L116Q

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 1.1e-31 PFAM
RRM 278 346 2.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116415
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112116
Gene: ENSMUSG00000031816
AA Change: L135Q

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 2.3e-36 PFAM
RRM 297 365 2.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126431
AA Change: L207Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119673
Gene: ENSMUSG00000031816
AA Change: L207Q

DomainStartEndE-ValueType
low complexity region 44 54 N/A INTRINSIC
Pfam:5-FTHF_cyc-lig 81 278 5.2e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128503
Predicted Effect probably damaging
Transcript: ENSMUST00000133037
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117429
Gene: ENSMUSG00000031816
AA Change: L135Q

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 9 206 7.8e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133058
Predicted Effect probably benign
Transcript: ENSMUST00000134758
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138908
Predicted Effect probably damaging
Transcript: ENSMUST00000139782
AA Change: L116Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115382
Gene: ENSMUSG00000031816
AA Change: L116Q

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 187 2.1e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149718
Predicted Effect probably benign
Transcript: ENSMUST00000151576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213028
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Mthfsd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Mthfsd APN 8 121104468 missense probably damaging 1.00
IGL03002:Mthfsd APN 8 121108279 splice site probably benign
R0076:Mthfsd UTSW 8 121098739 missense probably benign 0.04
R0416:Mthfsd UTSW 8 121101237 missense probably damaging 1.00
R2157:Mthfsd UTSW 8 121101501 missense probably damaging 1.00
R2851:Mthfsd UTSW 8 121105773 missense probably benign 0.38
R3439:Mthfsd UTSW 8 121099121 missense possibly damaging 0.89
R4207:Mthfsd UTSW 8 121105626 missense probably damaging 1.00
R4456:Mthfsd UTSW 8 121105765 missense possibly damaging 0.89
R4757:Mthfsd UTSW 8 121098998 critical splice donor site probably null
R5154:Mthfsd UTSW 8 121098740 missense probably damaging 1.00
R5208:Mthfsd UTSW 8 121108319 unclassified probably benign
R5496:Mthfsd UTSW 8 121098814 nonsense probably null
R6652:Mthfsd UTSW 8 121098821 missense probably damaging 1.00
R7309:Mthfsd UTSW 8 121108331 unclassified probably benign
R7538:Mthfsd UTSW 8 121098786 missense probably benign 0.41
R8072:Mthfsd UTSW 8 121098816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGATCACTACAACCATGAGCG -3'
(R):5'- CCATCTGATTATTCCCGGAACTGGC -3'

Sequencing Primer
(F):5'- TGTGAGAGAGACTCGATCCCTC -3'
(R):5'- CTGTCCCAGGACACTGC -3'
Posted On2013-09-30