Incidental Mutation 'R0745:Endod1'
ID70922
Institutional Source Beutler Lab
Gene Symbol Endod1
Ensembl Gene ENSMUSG00000037419
Gene Nameendonuclease domain containing 1
Synonyms2210414F18Rik, 2310067E08Rik
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14353990-14381507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 14357117 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 357 (N357K)
Ref Sequence ENSEMBL: ENSMUSP00000127751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167549]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167549
AA Change: N357K

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127751
Gene: ENSMUSG00000037419
AA Change: N357K

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Endonuclease_NS 61 261 9.04e-1 SMART
NUC 62 264 1.64e-3 SMART
coiled coil region 271 299 N/A INTRINSIC
transmembrane domain 343 365 N/A INTRINSIC
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 467 486 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213403
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Endod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Endod1 APN 9 14356753 missense possibly damaging 0.93
IGL01302:Endod1 APN 9 14357239 missense possibly damaging 0.50
IGL02895:Endod1 APN 9 14356870 missense probably benign 0.06
IGL02994:Endod1 APN 9 14356887 missense possibly damaging 0.93
IGL03120:Endod1 APN 9 14357035 missense probably damaging 0.98
royal_gorge UTSW 9 14356870 missense probably benign 0.06
R1087:Endod1 UTSW 9 14357193 missense possibly damaging 0.69
R1829:Endod1 UTSW 9 14356926 missense probably damaging 1.00
R1857:Endod1 UTSW 9 14357109 missense probably benign 0.05
R2120:Endod1 UTSW 9 14357653 missense probably benign 0.07
R3906:Endod1 UTSW 9 14380855 missense probably benign 0.12
R4801:Endod1 UTSW 9 14357023 missense probably benign 0.05
R4802:Endod1 UTSW 9 14357023 missense probably benign 0.05
R5017:Endod1 UTSW 9 14356891 nonsense probably null
R6027:Endod1 UTSW 9 14357597 nonsense probably null
R6179:Endod1 UTSW 9 14357461 missense probably benign 0.00
R6279:Endod1 UTSW 9 14356870 missense probably benign 0.06
R6300:Endod1 UTSW 9 14356870 missense probably benign 0.06
R6986:Endod1 UTSW 9 14357310 missense probably damaging 1.00
R7314:Endod1 UTSW 9 14356999 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TACATCCACAAGGACTCGGAGAGG -3'
(R):5'- GTCAACCAAGTCCAAGATGAGGAGC -3'

Sequencing Primer
(F):5'- GCAGACAGCCTTCAGCAG -3'
(R):5'- CAGTCTCAAGAGAGAATGAGTCCC -3'
Posted On2013-09-30