Incidental Mutation 'R0745:Dlat'
ID70924
Institutional Source Beutler Lab
Gene Symbol Dlat
Ensembl Gene ENSMUSG00000000168
Gene Namedihydrolipoamide S-acetyltransferase (E2 component of pyruvate dehydrogenase complex)
SynonymsPDC-E2, 6332404G05Rik
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location50634633-50659780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50653708 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 233 (T233M)
Ref Sequence ENSEMBL: ENSMUSP00000034567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034567]
Predicted Effect probably damaging
Transcript: ENSMUST00000034567
AA Change: T233M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034567
Gene: ENSMUSG00000000168
AA Change: T233M

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 91 164 4.3e-17 PFAM
low complexity region 183 210 N/A INTRINSIC
Pfam:Biotin_lipoyl 218 292 1.2e-17 PFAM
low complexity region 315 344 N/A INTRINSIC
Pfam:E3_binding 350 385 2.6e-18 PFAM
Pfam:2-oxoacid_dh 412 642 9.9e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155417
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes component E2 of the multi-enzyme pyruvate dehydrogenase complex (PDC). PDC resides in the inner mitochondrial membrane and catalyzes the conversion of pyruvate to acetyl coenzyme A. The protein product of this gene, dihydrolipoamide acetyltransferase, accepts acetyl groups formed by the oxidative decarboxylation of pyruvate and transfers them to coenzyme A. Dihydrolipoamide acetyltransferase is the antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC enventually leads to cirrhosis and liver failure. Mutations in this gene are also a cause of pyruvate dehydrogenase E2 deficiency which causes primary lactic acidosis in infancy and early childhood.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Dlat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Dlat APN 9 50645032 splice site probably benign
IGL00870:Dlat APN 9 50650869 missense probably damaging 1.00
R0440:Dlat UTSW 9 50645119 splice site probably null
R0530:Dlat UTSW 9 50637569 missense probably damaging 1.00
R1870:Dlat UTSW 9 50637574 missense probably damaging 0.99
R3237:Dlat UTSW 9 50638031 missense possibly damaging 0.81
R3696:Dlat UTSW 9 50650876 missense possibly damaging 0.63
R3715:Dlat UTSW 9 50638054 missense probably damaging 1.00
R3924:Dlat UTSW 9 50658190 missense possibly damaging 0.55
R4016:Dlat UTSW 9 50649631 critical splice donor site probably null
R4197:Dlat UTSW 9 50636526 missense probably damaging 1.00
R4713:Dlat UTSW 9 50644481 missense probably benign
R4789:Dlat UTSW 9 50659370 missense probably benign
R5893:Dlat UTSW 9 50644139 splice site probably benign
R6138:Dlat UTSW 9 50645117 splice site probably null
R6778:Dlat UTSW 9 50650857 missense probably damaging 1.00
R7010:Dlat UTSW 9 50657974 missense probably damaging 1.00
R8065:Dlat UTSW 9 50657849 missense possibly damaging 0.67
U15987:Dlat UTSW 9 50645117 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCACAGTACATGACTGCATGGTG -3'
(R):5'- CCTTTGTGATGGGTGACAAGGTCTC -3'

Sequencing Primer
(F):5'- GACTAATCTACACCCTGGGTACTG -3'
(R):5'- CACAGATTGTTCTTCCTGCC -3'
Posted On2013-09-30