Incidental Mutation 'R0745:Uba5'
ID70925
Institutional Source Beutler Lab
Gene Symbol Uba5
Ensembl Gene ENSMUSG00000032557
Gene Nameubiquitin-like modifier activating enzyme 5
SynonymsUbe1dc1, 5730525G14Rik
MMRRC Submission 038926-MU
Accession Numbers

Genbank: NM_025692; MGI: 1913913

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0745 (G1)
Quality Score89
Status Validated
Chromosome9
Chromosomal Location104046599-104063134 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 104049511 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000140768] [ENSMUST00000144195]
Predicted Effect probably benign
Transcript: ENSMUST00000035166
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140768
SMART Domains Protein: ENSMUSP00000118734
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 70 101 1.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144195
SMART Domains Protein: ENSMUSP00000118535
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
Pfam:ThiF 1 119 1.9e-22 PFAM
low complexity region 220 235 N/A INTRINSIC
low complexity region 246 256 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193689
Predicted Effect probably benign
Transcript: ENSMUST00000214222
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E1-like ubiquitin-activating enzyme family. This protein activates ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein, via the formation of a high-energy thioester bond. Alternative splicing results in multiple transcript variants. A pseudogene of this gene has been identified on chromosome 1. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele die at E12.5. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Uba5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Uba5 APN 9 104054060 splice site probably benign
IGL02891:Uba5 APN 9 104054193 splice site probably benign
IGL03182:Uba5 APN 9 104054129 missense possibly damaging 0.78
3-1:Uba5 UTSW 9 104060392 critical splice donor site probably null
PIT4810001:Uba5 UTSW 9 104055197 missense probably damaging 1.00
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R0033:Uba5 UTSW 9 104054148 missense probably benign 0.01
R1018:Uba5 UTSW 9 104049903 missense probably benign 0.00
R1163:Uba5 UTSW 9 104055826 missense possibly damaging 0.70
R1771:Uba5 UTSW 9 104049908 missense probably damaging 1.00
R2164:Uba5 UTSW 9 104060243 missense probably damaging 1.00
R3916:Uba5 UTSW 9 104054190 missense probably damaging 1.00
R5072:Uba5 UTSW 9 104054427 missense probably damaging 1.00
R5177:Uba5 UTSW 9 104049298 missense probably benign
R5563:Uba5 UTSW 9 104049247 missense probably benign 0.18
R6606:Uba5 UTSW 9 104055221 missense probably damaging 1.00
R7258:Uba5 UTSW 9 104062933 missense unknown
R7337:Uba5 UTSW 9 104055255 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGCCTTCAGGTAAGGTGGGAACAG -3'
(R):5'- AAGCCAAACCCTCAGTGTGATGAC -3'

Sequencing Primer
(F):5'- AGTTCCTCTTCTGAAACCTCAGAC -3'
(R):5'- CCTGGGACAGTGACTTTCAAG -3'
Posted On2013-09-30