Mutagenetix > Incidental Mutations

Incidental Mutation 'R0745:Eef2'

70927

Institutional Source

Beutler Lab

Gene Symbol

Eef2

Ensembl Gene

ENSMUSG00000034994

Gene Name

eukaryotic translation elongation factor 2

Synonyms

Ef-2

MMRRC Submission

038926-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.969) question?

Stock #

R0745 (G1)

Quality Score

139

Status

Validated

Chromosome

Chromosomal Location

81176631-81182498 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 81181996 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 831 (P831S)

Ref Sequence

ENSEMBL: ENSMUSP00000046101 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047665] [ENSMUST00000047864] [ENSMUST00000056086] [ENSMUST00000178422] [ENSMUST00000218157] [ENSMUST00000219133] [ENSMUST00000219850]

Predicted Effect

probably benign
Transcript: ENSMUST00000047665

SMART Domains

Protein: ENSMUSP00000035962
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000047864
AA Change: P831S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000046101
Gene: ENSMUSG00000034994
AA Change: P831S

Domain	Start	End	E-Value	Type
Pfam:GTP_EFTU	17	360	2e-65	PFAM
Pfam:MMR_HSR1	21	159	6.3e-6	PFAM
Pfam:GTP_EFTU_D2	409	486	2.3e-14	PFAM
Pfam:EFG_II	501	568	1.9e-14	PFAM
EFG_IV	621	737	5.56e-27	SMART
EFG_C	739	828	4.06e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000056086

SMART Domains

Protein: ENSMUSP00000049685
Gene: ENSMUSG00000053603

Domain	Start	End	E-Value	Type
low complexity region	2	14	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082507

Predicted Effect

probably benign
Transcript: ENSMUST00000178422

SMART Domains

Protein: ENSMUSP00000137333
Gene: ENSMUSG00000034974

Domain	Start	End	E-Value	Type
S_TKc	13	275	1.93e-98	SMART
low complexity region	288	299	N/A	INTRINSIC
low complexity region	331	347	N/A	INTRINSIC
low complexity region	349	411	N/A	INTRINSIC
coiled coil region	419	444	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217936

Predicted Effect

probably benign
Transcript: ENSMUST00000218157

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218698

Predicted Effect

probably benign
Transcript: ENSMUST00000219133

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219329

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219497

Predicted Effect

probably benign
Transcript: ENSMUST00000219850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219943

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220076

Meta Mutation Damage Score

0.0943

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 95.0%

Validation Efficiency

100% (40/40)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GTP-binding translation elongation factor family. This protein is an essential factor for protein synthesis. It promotes the GTP-dependent translocation of the nascent protein chain from the A-site to the P-site of the ribosome. This protein is completely inactivated by EF-2 kinase phosporylation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation removing the diphthamide modification display partial neonatal lethality, fetal growth retardation and abnormal cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,928,463	Y759C	probably damaging	Het
Abhd12	A	T	2: 150,833,148		probably null	Het
Adam17	A	G	12: 21,332,221		probably benign	Het
Aldh1l2	T	A	10: 83,518,630		probably null	Het
Brca2	A	T	5: 150,544,882		probably benign	Het
Capn13	A	C	17: 73,351,508	D188E	probably benign	Het
Col14a1	A	T	15: 55,338,417	T34S	unknown	Het
Col5a2	A	G	1: 45,407,227		probably null	Het
Cyp4v3	A	G	8: 45,308,651		probably benign	Het
Dlat	G	A	9: 50,653,708	T233M	probably damaging	Het
Endod1	A	T	9: 14,357,117	N357K	possibly damaging	Het
Evc	A	T	5: 37,319,059	V205E	probably damaging	Het
Fryl	A	G	5: 73,071,126	L1754P	probably damaging	Het
Gabra6	A	T	11: 42,316,567	M230K	probably damaging	Het
Hsd3b5	A	G	3: 98,619,539	V197A	probably benign	Het
Kmt2c	A	T	5: 25,359,698		probably null	Het
Mthfsd	A	T	8: 121,102,949	L116Q	probably damaging	Het
Mug1	A	G	6: 121,887,427	T1428A	probably benign	Het
Obscn	A	G	11: 59,082,239	V2312A	probably benign	Het
Olfr1357	T	C	10: 78,612,122	E173G	probably benign	Het
Palld	G	A	8: 61,877,703	R47C	probably damaging	Het
Pds5b	A	G	5: 150,805,671	T1424A	probably benign	Het
Ppp6r2	G	A	15: 89,265,242		probably null	Het
Sik3	A	G	9: 46,198,239	N505S	probably benign	Het
Spin1	A	G	13: 51,139,515	Y87C	probably damaging	Het
Tcp11	T	C	17: 28,067,160	I494V	possibly damaging	Het
Tgfa	G	A	6: 86,271,435	E140K	probably damaging	Het
Trappc9	G	A	15: 73,025,967	R377W	probably damaging	Het
Trmo	A	G	4: 46,382,104	F338L	probably damaging	Het
Tspan17	T	C	13: 54,789,674	V27A	possibly damaging	Het
Uba5	A	G	9: 104,049,511		probably benign	Het
Unc5a	CTGTGTGTGTGTGTGT	CTGTGTGTGTGTGT	13: 55,005,255		probably null	Het
Zbbx	C	T	3: 75,155,427	V8I	probably damaging	Het
Zcchc11	C	G	4: 108,502,955		probably benign	Het
Zfp451	A	T	1: 33,770,848	L931*	probably null	Het
Zmym4	A	T	4: 126,902,703		probably benign	Het

Other mutations in Eef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01303:Eef2	APN	10	81181943	missense	possibly damaging	0.93
IGL01303:Eef2	APN	10	81181982	splice site	probably null
IGL01376:Eef2	APN	10	81178049	unclassified	probably benign
IGL01876:Eef2	APN	10	81180270	missense	probably benign
IGL02000:Eef2	APN	10	81180011	missense	probably benign	0.13
IGL02514:Eef2	APN	10	81179593	missense	probably benign	0.11
IGL03087:Eef2	APN	10	81181247	missense	probably benign	0.12
IGL03389:Eef2	APN	10	81179706	missense	probably benign	0.40
fig	UTSW	10	81180292	missense	possibly damaging	0.50
R0052:Eef2	UTSW	10	81178768	frame shift	probably null
R0178:Eef2	UTSW	10	81180292	missense	possibly damaging	0.50
R0445:Eef2	UTSW	10	81178770	frame shift	probably null
R0497:Eef2	UTSW	10	81181586	missense	probably benign	0.00
R0539:Eef2	UTSW	10	81178768	frame shift	probably null
R0811:Eef2	UTSW	10	81178769	frame shift	probably null
R0812:Eef2	UTSW	10	81178769	frame shift	probably null
R0832:Eef2	UTSW	10	81178769	frame shift	probably null
R1136:Eef2	UTSW	10	81178769	frame shift	probably null
R1298:Eef2	UTSW	10	81178768	frame shift	probably null
R1549:Eef2	UTSW	10	81178768	frame shift	probably null
R1550:Eef2	UTSW	10	81180847	missense	probably benign	0.04
R2869:Eef2	UTSW	10	81178767	frame shift	probably null
R2870:Eef2	UTSW	10	81178767	frame shift	probably null
R2871:Eef2	UTSW	10	81178767	frame shift	probably null
R2872:Eef2	UTSW	10	81178767	frame shift	probably null
R3408:Eef2	UTSW	10	81178767	frame shift	probably null
R3414:Eef2	UTSW	10	81177858	missense	probably damaging	0.98
R4291:Eef2	UTSW	10	81179580	missense	probably benign	0.00
R4357:Eef2	UTSW	10	81178767	frame shift	probably null
R4433:Eef2	UTSW	10	81178768	frame shift	probably null
R4577:Eef2	UTSW	10	81178767	frame shift	probably null
R5154:Eef2	UTSW	10	81178767	frame shift	probably null
R5609:Eef2	UTSW	10	81178769	frame shift	probably null
R6545:Eef2	UTSW	10	81181114	missense	probably damaging	1.00
R6649:Eef2	UTSW	10	81178768	frame shift	probably null
R6650:Eef2	UTSW	10	81178768	frame shift	probably null
R7326:Eef2	UTSW	10	81181282	missense	probably benign	0.26
R7472:Eef2	UTSW	10	81179550	missense	probably benign	0.01
R7579:Eef2	UTSW	10	81178768	frame shift	probably null
R8013:Eef2	UTSW	10	81178196	missense	probably damaging	1.00
R8143:Eef2	UTSW	10	81181348	missense	probably damaging	1.00
Z1088:Eef2	UTSW	10	81181889	missense	probably damaging	1.00
Z1176:Eef2	UTSW	10	81181158	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTGCCTGTCAATGAGTCCTTTGG -3'
(R):5'- AAATGTTAAGAGCCGTGTCCCGCC -3'

Sequencing Primer
(F):5'- gctacaaactacacagagaaacc -3'
(R):5'- TGCAGAGAGATTCCCGCTATC -3'

Posted On

2013-09-30