Incidental Mutation 'R0745:Aldh1l2'
ID70928
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Namealdehyde dehydrogenase 1 family, member L2
Synonyms
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location83487450-83534140 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 83518630 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
Predicted Effect probably null
Transcript: ENSMUST00000020497
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect probably null
Transcript: ENSMUST00000146640
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5726:Aldh1l2 UTSW 10 83512306 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAGTTATGCAAACCTTCAGCAGG -3'
(R):5'- TGATGGACTCAAGCTTCCATTGGAC -3'

Sequencing Primer
(F):5'- CTAGGTAAGCAGAAATATGGGTTGTG -3'
(R):5'- TTCCATTGGACAGGCCGTG -3'
Posted On2013-09-30