Incidental Mutation 'R0745:Gabra6'
ID70929
Institutional Source Beutler Lab
Gene Symbol Gabra6
Ensembl Gene ENSMUSG00000020428
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit alpha 6
SynonymsGabra-6, alpha6, GABA-ARalpha6
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location42306437-42321072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42316567 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 230 (M230K)
Ref Sequence ENSEMBL: ENSMUSP00000126114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020703] [ENSMUST00000109286] [ENSMUST00000155218]
Predicted Effect probably damaging
Transcript: ENSMUST00000020703
AA Change: M220K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020703
Gene: ENSMUSG00000020428
AA Change: M220K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 230 2.4e-43 PFAM
Pfam:Neur_chan_memb 237 378 9.3e-43 PFAM
transmembrane domain 413 430 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109286
AA Change: M229K

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000104909
Gene: ENSMUSG00000020428
AA Change: M229K

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 31 239 2.4e-53 PFAM
Pfam:Neur_chan_memb 246 387 9.7e-43 PFAM
transmembrane domain 422 439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155218
AA Change: M230K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126114
Gene: ENSMUSG00000020428
AA Change: M230K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Neur_chan_LBD 32 240 2e-51 PFAM
Pfam:Neur_chan_memb 247 393 6.3e-35 PFAM
transmembrane domain 423 440 N/A INTRINSIC
Meta Mutation Damage Score 0.5815 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. At least 16 distinct subunits of GABA-A receptors have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal cerebellar cytoarchitecture and normal responses to ethanol, pentobarbital and general anesthetics. Mice homozygous for a reporter allele are behaviorally normal and lack a cochlear phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Gabra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Gabra6 APN 11 42317023 missense probably damaging 1.00
IGL01553:Gabra6 APN 11 42315196 missense probably damaging 1.00
IGL01801:Gabra6 APN 11 42315108 missense probably damaging 1.00
IGL02474:Gabra6 APN 11 42307417 missense probably benign
IGL03027:Gabra6 APN 11 42315153 missense probably damaging 1.00
IGL03111:Gabra6 APN 11 42317017 missense probably damaging 1.00
R0121:Gabra6 UTSW 11 42314971 missense probably benign
R0206:Gabra6 UTSW 11 42317079 nonsense probably null
R0240:Gabra6 UTSW 11 42314947 missense probably benign 0.01
R0726:Gabra6 UTSW 11 42315127 missense probably damaging 0.98
R0751:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R0789:Gabra6 UTSW 11 42315017 missense probably benign 0.00
R1666:Gabra6 UTSW 11 42317634 missense probably damaging 1.00
R1754:Gabra6 UTSW 11 42316561 missense probably damaging 1.00
R2317:Gabra6 UTSW 11 42317780 critical splice acceptor site probably null
R3605:Gabra6 UTSW 11 42314950 missense probably benign 0.00
R4647:Gabra6 UTSW 11 42307372 missense probably damaging 1.00
R5566:Gabra6 UTSW 11 42307490 missense probably benign
R5929:Gabra6 UTSW 11 42317562 missense probably damaging 0.99
R5930:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R5931:Gabra6 UTSW 11 42307441 missense probably benign 0.28
R6155:Gabra6 UTSW 11 42316523 missense probably damaging 1.00
R7249:Gabra6 UTSW 11 42317432 missense probably damaging 1.00
R7759:Gabra6 UTSW 11 42317681 missense probably damaging 1.00
R7783:Gabra6 UTSW 11 42316462 missense probably damaging 1.00
R7869:Gabra6 UTSW 11 42316495 missense possibly damaging 0.96
R7952:Gabra6 UTSW 11 42316495 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTGAGGCATACCAAAGACAGTTCTTG -3'
(R):5'- AGTCCCAGAAGAATCTTCTAGCCTCC -3'

Sequencing Primer
(F):5'- TACCAAAGACAGTTCTTGCTGGG -3'
(R):5'- CTCCAGTATGATTTGATTGGGCAAAC -3'
Posted On2013-09-30