Incidental Mutation 'R0745:Adam17'
ID70931
Institutional Source Beutler Lab
Gene Symbol Adam17
Ensembl Gene ENSMUSG00000052593
Gene Namea disintegrin and metallopeptidase domain 17
SynonymsCD156b, Tace
MMRRC Submission 038926-MU
Accession Numbers

Genbank: NM_009615; MGI: 1096335

Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location21323509-21373632 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 21332221 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064536] [ENSMUST00000101551] [ENSMUST00000127974] [ENSMUST00000145118] [ENSMUST00000232107] [ENSMUST00000232526]
Predicted Effect probably benign
Transcript: ENSMUST00000064536
SMART Domains Protein: ENSMUSP00000067953
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 1.1e-11 PFAM
Pfam:Reprolysin_5 221 451 6.7e-37 PFAM
Pfam:Reprolysin_4 221 469 3.2e-24 PFAM
Pfam:Reprolysin_2 244 464 8.8e-29 PFAM
Pfam:Reprolysin_3 248 416 1.2e-12 PFAM
Pfam:Reprolysin 383 474 3.1e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 642 4e-32 PDB
transmembrane domain 672 694 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101551
SMART Domains Protein: ENSMUSP00000099087
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 31 167 9.7e-15 PFAM
Pfam:Reprolysin_5 221 470 5e-34 PFAM
Pfam:Reprolysin_4 221 488 6.1e-20 PFAM
Pfam:Reprolysin_2 264 483 2.6e-34 PFAM
Pfam:Reprolysin_3 267 435 2.8e-14 PFAM
Pfam:Reprolysin 330 493 5.3e-9 PFAM
DISIN 503 580 6.27e-26 SMART
Pfam:ADAM17_MPD 600 661 1e-23 PFAM
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 758 774 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127974
SMART Domains Protein: ENSMUSP00000136677
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 25 167 9.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141799
Predicted Effect probably benign
Transcript: ENSMUST00000145118
SMART Domains Protein: ENSMUSP00000136407
Gene: ENSMUSG00000052593

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Pep_M12B_propep 28 167 7.5e-12 PFAM
Pfam:Reprolysin_5 221 451 4.2e-37 PFAM
Pfam:Reprolysin_4 221 469 2e-24 PFAM
Pfam:Reprolysin_2 244 464 5.6e-29 PFAM
Pfam:Reprolysin_3 248 416 7.8e-13 PFAM
Pfam:Reprolysin 381 474 2.2e-9 PFAM
DISIN 484 561 6.27e-26 SMART
PDB:2M2F|A 581 638 5e-29 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155115
Predicted Effect probably benign
Transcript: ENSMUST00000232107
Predicted Effect probably benign
Transcript: ENSMUST00000232526
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. The encoded preproprotein undergoes proteolytic processing to generate a mature enzyme that is involved in the proteolytic release of membrane-bound proteins in a process called ectodomain shedding. Mice lacking the encoded protein die in utero or fail to survive beyond one week of age. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Most mice homozygous for targeted mutations that inactivate the gene die perinatally with stunted vibrissae and open eyelids. Survivors display various degrees of eye degeneration, perturbed hair coats, curly vibrissae, and irregular pigmentation patterns. Histological analysis of fetuses reveal defects in epithelial cell maturation and organization in multiple organs. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(2) Targeted, other(3) Gene trapped(8)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Adam17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Adam17 APN 12 21328109 missense probably damaging 1.00
IGL01340:Adam17 APN 12 21330057 nonsense probably null
IGL01973:Adam17 APN 12 21349943 missense probably damaging 1.00
IGL02223:Adam17 APN 12 21361705 missense possibly damaging 0.92
IGL03153:Adam17 APN 12 21345697 missense probably damaging 1.00
Steinway UTSW 12 21353948 missense probably damaging 1.00
wavedx UTSW 12 21340750 missense probably damaging 1.00
R0014:Adam17 UTSW 12 21336644 missense probably benign 0.36
R0080:Adam17 UTSW 12 21329048 splice site probably benign
R0082:Adam17 UTSW 12 21329048 splice site probably benign
R0324:Adam17 UTSW 12 21349938 missense probably benign 0.00
R0511:Adam17 UTSW 12 21340458 splice site probably benign
R1314:Adam17 UTSW 12 21329071 missense probably damaging 1.00
R1547:Adam17 UTSW 12 21353957 missense probably damaging 1.00
R1594:Adam17 UTSW 12 21340470 critical splice donor site probably null
R1607:Adam17 UTSW 12 21334138 splice site probably null
R1812:Adam17 UTSW 12 21361767 missense probably damaging 0.97
R2020:Adam17 UTSW 12 21349875 missense probably damaging 1.00
R3408:Adam17 UTSW 12 21329118 missense probably damaging 1.00
R3735:Adam17 UTSW 12 21325412 missense probably benign 0.05
R3886:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R3888:Adam17 UTSW 12 21325587 missense probably damaging 1.00
R4062:Adam17 UTSW 12 21325457 missense probably damaging 1.00
R4415:Adam17 UTSW 12 21345701 missense possibly damaging 0.90
R4563:Adam17 UTSW 12 21332088 missense probably damaging 1.00
R4658:Adam17 UTSW 12 21332160 missense probably damaging 1.00
R4763:Adam17 UTSW 12 21334015 missense probably benign
R4793:Adam17 UTSW 12 21347395 missense probably benign
R5101:Adam17 UTSW 12 21373405 missense possibly damaging 0.85
R5120:Adam17 UTSW 12 21343019 intron probably benign
R5514:Adam17 UTSW 12 21340519 missense probably damaging 0.98
R5592:Adam17 UTSW 12 21334137 missense probably damaging 1.00
R5874:Adam17 UTSW 12 21329086 missense possibly damaging 0.76
R6110:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6451:Adam17 UTSW 12 21342882 missense probably benign 0.00
R6930:Adam17 UTSW 12 21353948 missense probably damaging 1.00
R6970:Adam17 UTSW 12 21345668 missense probably benign 0.06
R7213:Adam17 UTSW 12 21336678 nonsense probably null
R7302:Adam17 UTSW 12 21355693 intron probably benign
R7361:Adam17 UTSW 12 21325601 missense probably damaging 0.98
R7667:Adam17 UTSW 12 21333952 critical splice donor site probably null
R7799:Adam17 UTSW 12 21340492 missense probably damaging 1.00
R8762:Adam17 UTSW 12 21351594 missense probably benign 0.03
X0063:Adam17 UTSW 12 21332585 missense probably benign 0.17
Z1176:Adam17 UTSW 12 21361737 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCTTCCTCACTCTTGATGAGCAAC -3'
(R):5'- TTCCTTCAGGTGAAAGCAGCCC -3'

Sequencing Primer
(F):5'- TCTTGATGAGCAACAGACAAAAAGC -3'
(R):5'- tcctggctgtcctggaac -3'
Posted On2013-09-30