Incidental Mutation 'R0745:Spin1'
ID70932
Institutional Source Beutler Lab
Gene Symbol Spin1
Ensembl Gene ENSMUSG00000021395
Gene Namespindlin 1
SynonymsSpin
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location51100880-51152546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51139515 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 87 (Y87C)
Ref Sequence ENSEMBL: ENSMUSP00000093473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095797]
Predicted Effect probably damaging
Transcript: ENSMUST00000095797
AA Change: Y87C

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093473
Gene: ENSMUSG00000021395
AA Change: Y87C

DomainStartEndE-ValueType
Pfam:Spin-Ssty 54 103 7.3e-30 PFAM
Pfam:Spin-Ssty 133 182 1.2e-26 PFAM
Pfam:Spin-Ssty 214 259 1.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223152
Meta Mutation Damage Score 0.7806 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display complete postnatal lethality. Although mutant female mice exhibit normal follicular development and oocyte growth, fully grown oocytes are defective in resuming meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Spin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Spin1 APN 13 51144541 splice site probably null
IGL02825:Spin1 APN 13 51123296 splice site probably benign
IGL03366:Spin1 APN 13 51127937 missense probably benign 0.03
R0050:Spin1 UTSW 13 51150418 utr 3 prime probably benign
R0139:Spin1 UTSW 13 51149012 missense probably benign 0.01
R1394:Spin1 UTSW 13 51144481 missense probably damaging 1.00
R1674:Spin1 UTSW 13 51149099 missense probably damaging 1.00
R1980:Spin1 UTSW 13 51144470 missense probably damaging 1.00
R2070:Spin1 UTSW 13 51144537 critical splice donor site probably null
R5326:Spin1 UTSW 13 51139527 missense probably damaging 1.00
R5741:Spin1 UTSW 13 51149135 missense possibly damaging 0.81
R6030:Spin1 UTSW 13 51139516 nonsense probably null
R6030:Spin1 UTSW 13 51139516 nonsense probably null
R6182:Spin1 UTSW 13 51144338 missense probably benign
R7423:Spin1 UTSW 13 51123290 critical splice donor site probably null
R7555:Spin1 UTSW 13 51149049 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAACATCGGACCAGTGTGGGACC -3'
(R):5'- AAGGCTCTTCATCACGCCCTGAAC -3'

Sequencing Primer
(F):5'- GACCAAGCAAGCCTGTGTC -3'
(R):5'- ATGGTTTCAGAACATCTGCCTG -3'
Posted On2013-09-30