Incidental Mutation 'R0745:Tspan17'
ID70933
Institutional Source Beutler Lab
Gene Symbol Tspan17
Ensembl Gene ENSMUSG00000025875
Gene Nametetraspanin 17
Synonyms2210021G21Rik, Fbxo23, Tm4sf17
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location54789377-54796776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54789674 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 27 (V27A)
Ref Sequence ENSEMBL: ENSMUSP00000130765 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026993] [ENSMUST00000099503] [ENSMUST00000110003] [ENSMUST00000126525] [ENSMUST00000126785] [ENSMUST00000130568] [ENSMUST00000131692] [ENSMUST00000132005] [ENSMUST00000132415] [ENSMUST00000132728] [ENSMUST00000139184] [ENSMUST00000141398] [ENSMUST00000142158] [ENSMUST00000152204] [ENSMUST00000163796] [ENSMUST00000163915]
Predicted Effect probably benign
Transcript: ENSMUST00000026993
AA Change: V27A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026993
Gene: ENSMUSG00000025875
AA Change: V27A

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 263 6.9e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099503
AA Change: V27A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097102
Gene: ENSMUSG00000025875
AA Change: V27A

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 266 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110003
SMART Domains Protein: ENSMUSP00000105630
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 227 2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126525
SMART Domains Protein: ENSMUSP00000121625
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
Pfam:IF4E 63 111 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126785
SMART Domains Protein: ENSMUSP00000118697
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 9 30 N/A INTRINSIC
Pfam:IF4E 72 234 1.7e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130568
SMART Domains Protein: ENSMUSP00000123607
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 3 174 1.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131692
AA Change: V27A

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000115287
Gene: ENSMUSG00000025875
AA Change: V27A

DomainStartEndE-ValueType
Pfam:Tetraspannin 15 263 8.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132005
SMART Domains Protein: ENSMUSP00000116681
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 175 3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132415
SMART Domains Protein: ENSMUSP00000120733
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
Pfam:IF4E 63 162 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132728
SMART Domains Protein: ENSMUSP00000123294
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 228 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139184
SMART Domains Protein: ENSMUSP00000119305
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 134 4.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141398
SMART Domains Protein: ENSMUSP00000114217
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
Pfam:IF4E 1 90 6.6e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142158
SMART Domains Protein: ENSMUSP00000117092
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
Pfam:IF4E 71 233 4.8e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145574
SMART Domains Protein: ENSMUSP00000119687
Gene: ENSMUSG00000025875

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 174 8.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152204
SMART Domains Protein: ENSMUSP00000120619
Gene: ENSMUSG00000074895

DomainStartEndE-ValueType
low complexity region 3 24 N/A INTRINSIC
Pfam:IF4E 66 170 9.1e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163796
AA Change: V27A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131671
Gene: ENSMUSG00000025875
AA Change: V27A

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 193 4.3e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163915
AA Change: V27A

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000130765
Gene: ENSMUSG00000025875
AA Change: V27A

DomainStartEndE-ValueType
Pfam:Tetraspannin 13 143 5e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171859
AA Change: V10A
SMART Domains Protein: ENSMUSP00000128568
Gene: ENSMUSG00000025875
AA Change: V10A

DomainStartEndE-ValueType
Pfam:Tetraspannin 1 79 3.6e-17 PFAM
Pfam:Tetraspannin 78 144 1.5e-13 PFAM
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transmembrane 4 superfamily. It is characterized by four tetraspanin transmembrane segments. The function of this gene has not yet been determined. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Tspan17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02681:Tspan17 APN 13 54789629 missense probably damaging 0.99
R1128:Tspan17 UTSW 13 54795171 missense probably damaging 1.00
R4738:Tspan17 UTSW 13 54795064 nonsense probably null
R5905:Tspan17 UTSW 13 54793298 missense probably damaging 0.98
R6028:Tspan17 UTSW 13 54793298 missense probably damaging 0.98
R6389:Tspan17 UTSW 13 54795616 unclassified probably null
R6919:Tspan17 UTSW 13 54796033 missense probably damaging 1.00
R7050:Tspan17 UTSW 13 54796063 missense probably benign 0.39
R7346:Tspan17 UTSW 13 54792621 missense probably benign 0.01
R7408:Tspan17 UTSW 13 54789653 missense probably benign 0.15
R7429:Tspan17 UTSW 13 54795972 missense probably benign 0.03
R7430:Tspan17 UTSW 13 54795972 missense probably benign 0.03
Z1177:Tspan17 UTSW 13 54792778 frame shift probably null
Z1177:Tspan17 UTSW 13 54796221 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGAGGACTGAACTTGACTGGGACG -3'
(R):5'- ACTTGGGGCTGCAAAGAGAGACTC -3'

Sequencing Primer
(F):5'- TTTGACCATGAAGCCGCAG -3'
(R):5'- ACCTCCTGCTGGGACTG -3'
Posted On2013-09-30