Incidental Mutation 'R9371:Nrde2'
ID 709330
Institutional Source Beutler Lab
Gene Symbol Nrde2
Ensembl Gene ENSMUSG00000021179
Gene Name nrde-2 necessary for RNA interference, domain containing
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9371 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 100125452-100159653 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100126218 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1126 (S1126G)
Ref Sequence ENSEMBL: ENSMUSP00000021596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021595] [ENSMUST00000021596]
AlphaFold Q80XC6
Predicted Effect probably benign
Transcript: ENSMUST00000021595
SMART Domains Protein: ENSMUSP00000021595
Gene: ENSMUSG00000021178

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
AAA 218 357 1.57e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021596
AA Change: S1126G

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021596
Gene: ENSMUSG00000021179
AA Change: S1126G

DomainStartEndE-ValueType
low complexity region 85 107 N/A INTRINSIC
low complexity region 146 154 N/A INTRINSIC
Pfam:NRDE-2 318 658 1.2e-107 PFAM
Blast:HAT 765 800 2e-10 BLAST
Blast:HAT 802 841 3e-16 BLAST
Blast:HAT 986 1018 3e-10 BLAST
Blast:HAT 1075 1109 1e-14 BLAST
Blast:HAT 1111 1143 8e-15 BLAST
low complexity region 1154 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A T 9: 103,281,053 Y103N probably benign Het
1810009J06Rik T C 6: 40,966,729 I109T probably damaging Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
9130204L05Rik T C 3: 91,090,391 T6A unknown Het
Abca8b T G 11: 109,967,672 Q568P probably damaging Het
Add3 A G 19: 53,233,068 T204A probably damaging Het
Afg3l2 C A 18: 67,434,192 R196L possibly damaging Het
Agps T A 2: 75,911,680 probably null Het
Akap9 A G 5: 3,961,852 S852G possibly damaging Het
Aoc1 A G 6: 48,906,168 D326G probably benign Het
Cecr2 A G 6: 120,762,268 T1319A probably benign Het
Cenpo C T 12: 4,216,686 V141I probably benign Het
Clca4b A G 3: 144,926,084 L220S possibly damaging Het
Dicer1 A G 12: 104,704,732 L1017P probably damaging Het
Ero1lb T G 13: 12,574,847 C44G probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Fmo3 T A 1: 162,968,712 E97V probably benign Het
Gcnt4 G T 13: 96,947,126 R310L possibly damaging Het
Gm30302 G C 13: 49,785,576 T886S unknown Het
Gm7298 A G 6: 121,767,582 I520V probably benign Het
Gmpr T C 13: 45,545,995 L327P probably damaging Het
Grid2 T A 6: 64,700,522 H108Q unknown Het
Hmcn2 G T 2: 31,411,905 L2935F probably damaging Het
Hnf1b T C 11: 83,889,160 S440P probably benign Het
Hsph1 A T 5: 149,619,930 Y644N probably damaging Het
Igf2r A G 17: 12,705,759 I1057T possibly damaging Het
Igfn1 T C 1: 135,978,263 E269G probably damaging Het
Igkv14-126 A G 6: 67,896,368 T27A possibly damaging Het
Kcnj15 A G 16: 95,296,697 R393G unknown Het
Lamb1 A G 12: 31,298,864 T632A probably damaging Het
Lrrk2 T C 15: 91,723,204 L590P probably damaging Het
Mrm3 A G 11: 76,247,460 T225A possibly damaging Het
Mthfd1l A G 10: 4,103,335 T895A possibly damaging Het
Myh1 G A 11: 67,219,805 probably null Het
Naip2 T A 13: 100,161,846 K561* probably null Het
Necab2 C T 8: 119,447,184 P44S probably benign Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr127 A G 17: 37,904,071 H175R probably benign Het
Olfr895 T A 9: 38,268,630 V31E possibly damaging Het
Pecam1 T G 11: 106,691,121 D333A probably benign Het
Rapgef2 T C 3: 79,174,993 E100G probably damaging Het
Rnft2 A G 5: 118,202,917 F299L probably damaging Het
Rptor A G 11: 119,671,326 N105S possibly damaging Het
Scgb2b3 T A 7: 31,360,217 H44L probably benign Het
Slc22a17 A T 14: 54,909,682 V53D possibly damaging Het
Slc39a14 G A 14: 70,310,120 T298M probably benign Het
Sorbs1 G A 19: 40,326,880 T496M probably damaging Het
Taar8a T C 10: 24,076,855 V119A probably benign Het
Tas1r3 T C 4: 155,860,602 T721A possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmie A T 9: 110,867,583 C77S probably damaging Het
Tpp2 T A 1: 43,960,209 I381K probably damaging Het
Ttn G C 2: 76,946,478 A1526G unknown Het
Vmn2r12 T A 5: 109,086,586 M587L probably benign Het
Zeb2 G T 2: 44,998,900 H344Q probably damaging Het
Zfp292 A G 4: 34,810,800 I753T probably damaging Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfp677 C T 17: 21,397,791 T370M probably damaging Het
Zfp947 G A 17: 22,145,403 T430I possibly damaging Het
Other mutations in Nrde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02207:Nrde2 APN 12 100130931 missense probably benign 0.01
IGL02697:Nrde2 APN 12 100131207 missense probably damaging 1.00
IGL02798:Nrde2 APN 12 100143822 nonsense probably null
IGL02810:Nrde2 APN 12 100143758 missense possibly damaging 0.81
IGL02814:Nrde2 APN 12 100144135 missense probably null 0.80
IGL02990:Nrde2 APN 12 100142096 missense probably damaging 1.00
kurtz UTSW 12 100134405 missense possibly damaging 0.92
R0090:Nrde2 UTSW 12 100129286 splice site probably benign
R0576:Nrde2 UTSW 12 100132233 missense possibly damaging 0.82
R0646:Nrde2 UTSW 12 100143846 nonsense probably null
R1130:Nrde2 UTSW 12 100125670 missense probably damaging 0.97
R1216:Nrde2 UTSW 12 100149810 splice site probably benign
R1661:Nrde2 UTSW 12 100149860 missense probably benign 0.19
R2069:Nrde2 UTSW 12 100142232 missense probably damaging 1.00
R4405:Nrde2 UTSW 12 100130584 missense probably benign 0.01
R4422:Nrde2 UTSW 12 100146027 nonsense probably null
R5169:Nrde2 UTSW 12 100129293 critical splice donor site probably null
R5200:Nrde2 UTSW 12 100130497 missense possibly damaging 0.77
R5338:Nrde2 UTSW 12 100130778 missense probably damaging 1.00
R5512:Nrde2 UTSW 12 100142250 missense probably benign 0.20
R5820:Nrde2 UTSW 12 100132287 missense probably benign 0.00
R6019:Nrde2 UTSW 12 100132242 missense probably benign 0.04
R6346:Nrde2 UTSW 12 100132306 missense probably benign 0.01
R6378:Nrde2 UTSW 12 100130757 missense probably damaging 0.99
R6479:Nrde2 UTSW 12 100143948 missense probably benign 0.00
R6523:Nrde2 UTSW 12 100134405 missense possibly damaging 0.92
R7073:Nrde2 UTSW 12 100132488 missense probably benign 0.00
R7220:Nrde2 UTSW 12 100130919 missense probably benign 0.05
R7412:Nrde2 UTSW 12 100142250 nonsense probably null
R7505:Nrde2 UTSW 12 100132498 missense probably benign 0.15
R7699:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7700:Nrde2 UTSW 12 100130835 missense probably benign 0.16
R7733:Nrde2 UTSW 12 100144140 missense possibly damaging 0.92
R7868:Nrde2 UTSW 12 100131187 missense possibly damaging 0.65
R7963:Nrde2 UTSW 12 100149868 missense probably damaging 0.99
R8131:Nrde2 UTSW 12 100142243 missense probably benign 0.02
R8213:Nrde2 UTSW 12 100131003 missense probably benign
R9061:Nrde2 UTSW 12 100143864 missense probably benign 0.00
R9142:Nrde2 UTSW 12 100151259 missense probably benign 0.15
R9412:Nrde2 UTSW 12 100130422 nonsense probably null
R9468:Nrde2 UTSW 12 100140009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTACAGGGACAGTCACAAG -3'
(R):5'- AGAGTGTTGTCTGCCACTG -3'

Sequencing Primer
(F):5'- ACAAGGAGCTCTGGTGCTG -3'
(R):5'- TTGTCTGCCACTGGGAAC -3'
Posted On 2022-04-18