Mutagenetix > Incidental Mutations

Incidental Mutation 'R9371:Afg3l2'

709345

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9371 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 67434192 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 196 (R196L)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000025408
AA Change: R196L

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: R196L

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	T	9: 103,281,053	Y103N	probably benign	Het
1810009J06Rik	T	C	6: 40,966,729	I109T	probably damaging	Het
2200002D01Rik	CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC	7: 29,247,623		probably benign	Het
9130204L05Rik	T	C	3: 91,090,391	T6A	unknown	Het
Abca8b	T	G	11: 109,967,672	Q568P	probably damaging	Het
Add3	A	G	19: 53,233,068	T204A	probably damaging	Het
Agps	T	A	2: 75,911,680		probably null	Het
Akap9	A	G	5: 3,961,852	S852G	possibly damaging	Het
Aoc1	A	G	6: 48,906,168	D326G	probably benign	Het
Cecr2	A	G	6: 120,762,268	T1319A	probably benign	Het
Cenpo	C	T	12: 4,216,686	V141I	probably benign	Het
Clca4b	A	G	3: 144,926,084	L220S	possibly damaging	Het
Dicer1	A	G	12: 104,704,732	L1017P	probably damaging	Het
Ero1lb	T	G	13: 12,574,847	C44G	probably damaging	Het
Ffar2	A	T	7: 30,819,504	W204R	probably benign	Het
Fmo3	T	A	1: 162,968,712	E97V	probably benign	Het
Gcnt4	G	T	13: 96,947,126	R310L	possibly damaging	Het
Gm30302	G	C	13: 49,785,576	T886S	unknown	Het
Gm7298	A	G	6: 121,767,582	I520V	probably benign	Het
Gmpr	T	C	13: 45,545,995	L327P	probably damaging	Het
Grid2	T	A	6: 64,700,522	H108Q	unknown	Het
Hmcn2	G	T	2: 31,411,905	L2935F	probably damaging	Het
Hnf1b	T	C	11: 83,889,160	S440P	probably benign	Het
Hsph1	A	T	5: 149,619,930	Y644N	probably damaging	Het
Igf2r	A	G	17: 12,705,759	I1057T	possibly damaging	Het
Igfn1	T	C	1: 135,978,263	E269G	probably damaging	Het
Igkv14-126	A	G	6: 67,896,368	T27A	possibly damaging	Het
Kcnj15	A	G	16: 95,296,697	R393G	unknown	Het
Lamb1	A	G	12: 31,298,864	T632A	probably damaging	Het
Lrrk2	T	C	15: 91,723,204	L590P	probably damaging	Het
Mrm3	A	G	11: 76,247,460	T225A	possibly damaging	Het
Mthfd1l	A	G	10: 4,103,335	T895A	possibly damaging	Het
Myh1	G	A	11: 67,219,805		probably null	Het
Naip2	T	A	13: 100,161,846	K561*	probably null	Het
Necab2	C	T	8: 119,447,184	P44S	probably benign	Het
Nrde2	T	C	12: 100,126,218	S1126G	probably benign	Het
Nup210l	C	T	3: 90,199,866	P1570L	probably benign	Het
Olfr127	A	G	17: 37,904,071	H175R	probably benign	Het
Olfr895	T	A	9: 38,268,630	V31E	possibly damaging	Het
Pecam1	T	G	11: 106,691,121	D333A	probably benign	Het
Rapgef2	T	C	3: 79,174,993	E100G	probably damaging	Het
Rnft2	A	G	5: 118,202,917	F299L	probably damaging	Het
Rptor	A	G	11: 119,671,326	N105S	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,217	H44L	probably benign	Het
Slc22a17	A	T	14: 54,909,682	V53D	possibly damaging	Het
Slc39a14	G	A	14: 70,310,120	T298M	probably benign	Het
Sorbs1	G	A	19: 40,326,880	T496M	probably damaging	Het
Taar8a	T	C	10: 24,076,855	V119A	probably benign	Het
Tas1r3	T	C	4: 155,860,602	T721A	possibly damaging	Het
Tm7sf3	C	T	6: 146,623,681	D89N	possibly damaging	Het
Tmie	A	T	9: 110,867,583	C77S	probably damaging	Het
Tpp2	T	A	1: 43,960,209	I381K	probably damaging	Het
Ttn	G	C	2: 76,946,478	A1526G	unknown	Het
Vmn2r12	T	A	5: 109,086,586	M587L	probably benign	Het
Zeb2	G	T	2: 44,998,900	H344Q	probably damaging	Het
Zfp292	A	G	4: 34,810,800	I753T	probably damaging	Het
Zfp442	A	T	2: 150,408,756	C409S	unknown	Het
Zfp677	C	T	17: 21,397,791	T370M	probably damaging	Het
Zfp947	G	A	17: 22,145,403	T430I	possibly damaging	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6134:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GAAGCCTTTCCACACAGCAG -3'
(R):5'- ACCTGGATGACTGGCTGTAGAG -3'

Sequencing Primer
(F):5'- AGCAGCTGGTGTCAGTGC -3'
(R):5'- ATGACTGGCTGTAGAGACTGG -3'

Posted On

2022-04-18