Incidental Mutation 'R9371:Afg3l2'
ID 709345
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9371 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67434192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 196 (R196L)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect possibly damaging
Transcript: ENSMUST00000025408
AA Change: R196L

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: R196L

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A T 9: 103,281,053 Y103N probably benign Het
1810009J06Rik T C 6: 40,966,729 I109T probably damaging Het
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
9130204L05Rik T C 3: 91,090,391 T6A unknown Het
Abca8b T G 11: 109,967,672 Q568P probably damaging Het
Add3 A G 19: 53,233,068 T204A probably damaging Het
Agps T A 2: 75,911,680 probably null Het
Akap9 A G 5: 3,961,852 S852G possibly damaging Het
Aoc1 A G 6: 48,906,168 D326G probably benign Het
Cecr2 A G 6: 120,762,268 T1319A probably benign Het
Cenpo C T 12: 4,216,686 V141I probably benign Het
Clca4b A G 3: 144,926,084 L220S possibly damaging Het
Dicer1 A G 12: 104,704,732 L1017P probably damaging Het
Ero1lb T G 13: 12,574,847 C44G probably damaging Het
Ffar2 A T 7: 30,819,504 W204R probably benign Het
Fmo3 T A 1: 162,968,712 E97V probably benign Het
Gcnt4 G T 13: 96,947,126 R310L possibly damaging Het
Gm30302 G C 13: 49,785,576 T886S unknown Het
Gm7298 A G 6: 121,767,582 I520V probably benign Het
Gmpr T C 13: 45,545,995 L327P probably damaging Het
Grid2 T A 6: 64,700,522 H108Q unknown Het
Hmcn2 G T 2: 31,411,905 L2935F probably damaging Het
Hnf1b T C 11: 83,889,160 S440P probably benign Het
Hsph1 A T 5: 149,619,930 Y644N probably damaging Het
Igf2r A G 17: 12,705,759 I1057T possibly damaging Het
Igfn1 T C 1: 135,978,263 E269G probably damaging Het
Igkv14-126 A G 6: 67,896,368 T27A possibly damaging Het
Kcnj15 A G 16: 95,296,697 R393G unknown Het
Lamb1 A G 12: 31,298,864 T632A probably damaging Het
Lrrk2 T C 15: 91,723,204 L590P probably damaging Het
Mrm3 A G 11: 76,247,460 T225A possibly damaging Het
Mthfd1l A G 10: 4,103,335 T895A possibly damaging Het
Myh1 G A 11: 67,219,805 probably null Het
Naip2 T A 13: 100,161,846 K561* probably null Het
Necab2 C T 8: 119,447,184 P44S probably benign Het
Nrde2 T C 12: 100,126,218 S1126G probably benign Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr127 A G 17: 37,904,071 H175R probably benign Het
Olfr895 T A 9: 38,268,630 V31E possibly damaging Het
Pecam1 T G 11: 106,691,121 D333A probably benign Het
Rapgef2 T C 3: 79,174,993 E100G probably damaging Het
Rnft2 A G 5: 118,202,917 F299L probably damaging Het
Rptor A G 11: 119,671,326 N105S possibly damaging Het
Scgb2b3 T A 7: 31,360,217 H44L probably benign Het
Slc22a17 A T 14: 54,909,682 V53D possibly damaging Het
Slc39a14 G A 14: 70,310,120 T298M probably benign Het
Sorbs1 G A 19: 40,326,880 T496M probably damaging Het
Taar8a T C 10: 24,076,855 V119A probably benign Het
Tas1r3 T C 4: 155,860,602 T721A possibly damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmie A T 9: 110,867,583 C77S probably damaging Het
Tpp2 T A 1: 43,960,209 I381K probably damaging Het
Ttn G C 2: 76,946,478 A1526G unknown Het
Vmn2r12 T A 5: 109,086,586 M587L probably benign Het
Zeb2 G T 2: 44,998,900 H344Q probably damaging Het
Zfp292 A G 4: 34,810,800 I753T probably damaging Het
Zfp442 A T 2: 150,408,756 C409S unknown Het
Zfp677 C T 17: 21,397,791 T370M probably damaging Het
Zfp947 G A 17: 22,145,403 T430I possibly damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GAAGCCTTTCCACACAGCAG -3'
(R):5'- ACCTGGATGACTGGCTGTAGAG -3'

Sequencing Primer
(F):5'- AGCAGCTGGTGTCAGTGC -3'
(R):5'- ATGACTGGCTGTAGAGACTGG -3'
Posted On 2022-04-18