Incidental Mutation 'R0745:Tcp11'
ID70937
Institutional Source Beutler Lab
Gene Symbol Tcp11
Ensembl Gene ENSMUSG00000062859
Gene Namet-complex protein 11
SynonymsD17Ken1, Tcp-11
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location28066747-28080639 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28067160 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 494 (I494V)
Ref Sequence ENSEMBL: ENSMUSP00000038590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025058] [ENSMUST00000042692] [ENSMUST00000043925] [ENSMUST00000088027] [ENSMUST00000114836] [ENSMUST00000114842] [ENSMUST00000129046]
Predicted Effect probably benign
Transcript: ENSMUST00000025058
SMART Domains Protein: ENSMUSP00000025058
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
low complexity region 1126 1135 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000042692
AA Change: I494V

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038590
Gene: ENSMUSG00000062859
AA Change: I494V

DomainStartEndE-ValueType
Pfam:Tcp11 126 550 6.2e-102 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000043925
AA Change: I415V

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046002
Gene: ENSMUSG00000062859
AA Change: I415V

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088027
SMART Domains Protein: ENSMUSP00000085344
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 144 173 1.88e-5 SMART
ANK 177 206 1.93e-2 SMART
ANK 210 239 1.64e-5 SMART
ANK 242 271 7.71e-2 SMART
low complexity region 398 418 N/A INTRINSIC
low complexity region 612 626 N/A INTRINSIC
SAM 688 757 3.2e-16 SMART
SAM 762 830 4.33e-13 SMART
Blast:PTB 840 898 2e-22 BLAST
PTB 932 1066 3.17e-43 SMART
low complexity region 1105 1114 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114836
AA Change: I415V

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110485
Gene: ENSMUSG00000062859
AA Change: I415V

DomainStartEndE-ValueType
Pfam:Tcp11 44 474 3.3e-129 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114842
SMART Domains Protein: ENSMUSP00000110491
Gene: ENSMUSG00000024219

DomainStartEndE-ValueType
low complexity region 22 62 N/A INTRINSIC
ANK 75 104 1.08e-5 SMART
ANK 108 137 7.42e-4 SMART
ANK 165 194 1.88e-5 SMART
ANK 198 227 1.93e-2 SMART
ANK 231 260 1.64e-5 SMART
ANK 263 292 7.71e-2 SMART
low complexity region 419 439 N/A INTRINSIC
low complexity region 633 647 N/A INTRINSIC
SAM 709 778 3.2e-16 SMART
SAM 783 851 4.33e-13 SMART
Blast:PTB 861 919 2e-22 BLAST
PTB 953 1087 3.17e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123628
Predicted Effect probably benign
Transcript: ENSMUST00000129046
SMART Domains Protein: ENSMUSP00000116959
Gene: ENSMUSG00000062859

DomainStartEndE-ValueType
Pfam:Tcp11 44 237 2.5e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139173
Meta Mutation Damage Score 0.1238 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Capn13 A C 17: 73,351,508 D188E probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Tcp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02993:Tcp11 APN 17 28070516 missense probably damaging 1.00
IGL03148:Tcp11 APN 17 28070470 missense possibly damaging 0.95
R0487:Tcp11 UTSW 17 28079923 splice site probably null
R0603:Tcp11 UTSW 17 28067810 missense probably damaging 1.00
R1170:Tcp11 UTSW 17 28071662 missense probably damaging 1.00
R2965:Tcp11 UTSW 17 28069265 missense probably benign 0.38
R5249:Tcp11 UTSW 17 28071783 missense possibly damaging 0.71
R5358:Tcp11 UTSW 17 28078020 missense probably benign 0.05
R5819:Tcp11 UTSW 17 28069236 missense probably damaging 1.00
R6190:Tcp11 UTSW 17 28071717 missense probably benign 0.00
R6657:Tcp11 UTSW 17 28071672 missense probably damaging 1.00
R6698:Tcp11 UTSW 17 28071830 missense possibly damaging 0.63
R7020:Tcp11 UTSW 17 28071705 missense possibly damaging 0.79
R7084:Tcp11 UTSW 17 28067021 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GCAAACACCTGCTGGTTGTGATGG -3'
(R):5'- TGAGTCTCTGTGACATCCACACCC -3'

Sequencing Primer
(F):5'- TGGGTCAGGCTGACAAACTTC -3'
(R):5'- tttcccccctgcctctg -3'
Posted On2013-09-30