Incidental Mutation 'R0745:Capn13'
ID70938
Institutional Source Beutler Lab
Gene Symbol Capn13
Ensembl Gene ENSMUSG00000043705
Gene Namecalpain 13
SynonymsLOC381122
MMRRC Submission 038926-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R0745 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73306464-73399296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 73351508 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 188 (D188E)
Ref Sequence ENSEMBL: ENSMUSP00000092832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095208]
Predicted Effect probably benign
Transcript: ENSMUST00000095208
AA Change: D188E

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092832
Gene: ENSMUSG00000043705
AA Change: D188E

DomainStartEndE-ValueType
CysPc 12 337 3.23e-113 SMART
Pfam:Calpain_III 341 473 2e-13 PFAM
SCOP:d1k94a_ 512 664 3e-8 SMART
Meta Mutation Damage Score 0.2110 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The calpains, calcium-activated neutral proteases, are nonlysosomal, intracellular cysteine proteases. The mammalian calpains include ubiquitous, stomach-specific, and muscle-specific proteins. The ubiquitous enzymes consist of heterodimers with distinct large, catalytic subunits associated with a common small, regulatory subunit. This gene encodes a member of the calpain large subunit family. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,928,463 Y759C probably damaging Het
Abhd12 A T 2: 150,833,148 probably null Het
Adam17 A G 12: 21,332,221 probably benign Het
Aldh1l2 T A 10: 83,518,630 probably null Het
Brca2 A T 5: 150,544,882 probably benign Het
Col14a1 A T 15: 55,338,417 T34S unknown Het
Col5a2 A G 1: 45,407,227 probably null Het
Cyp4v3 A G 8: 45,308,651 probably benign Het
Dlat G A 9: 50,653,708 T233M probably damaging Het
Eef2 C T 10: 81,181,996 P831S probably benign Het
Endod1 A T 9: 14,357,117 N357K possibly damaging Het
Evc A T 5: 37,319,059 V205E probably damaging Het
Fryl A G 5: 73,071,126 L1754P probably damaging Het
Gabra6 A T 11: 42,316,567 M230K probably damaging Het
Hsd3b5 A G 3: 98,619,539 V197A probably benign Het
Kmt2c A T 5: 25,359,698 probably null Het
Mthfsd A T 8: 121,102,949 L116Q probably damaging Het
Mug1 A G 6: 121,887,427 T1428A probably benign Het
Obscn A G 11: 59,082,239 V2312A probably benign Het
Olfr1357 T C 10: 78,612,122 E173G probably benign Het
Palld G A 8: 61,877,703 R47C probably damaging Het
Pds5b A G 5: 150,805,671 T1424A probably benign Het
Ppp6r2 G A 15: 89,265,242 probably null Het
Sik3 A G 9: 46,198,239 N505S probably benign Het
Spin1 A G 13: 51,139,515 Y87C probably damaging Het
Tcp11 T C 17: 28,067,160 I494V possibly damaging Het
Tgfa G A 6: 86,271,435 E140K probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trmo A G 4: 46,382,104 F338L probably damaging Het
Tspan17 T C 13: 54,789,674 V27A possibly damaging Het
Uba5 A G 9: 104,049,511 probably benign Het
Unc5a CTGTGTGTGTGTGTGT CTGTGTGTGTGTGT 13: 55,005,255 probably null Het
Zbbx C T 3: 75,155,427 V8I probably damaging Het
Zcchc11 C G 4: 108,502,955 probably benign Het
Zfp451 A T 1: 33,770,848 L931* probably null Het
Zmym4 A T 4: 126,902,703 probably benign Het
Other mutations in Capn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Capn13 APN 17 73339425 missense possibly damaging 0.82
IGL01099:Capn13 APN 17 73351509 missense probably damaging 0.99
IGL01613:Capn13 APN 17 73331058 missense probably benign 0.07
IGL02215:Capn13 APN 17 73330998 missense probably damaging 1.00
IGL02403:Capn13 APN 17 73351426 missense possibly damaging 0.82
IGL02877:Capn13 APN 17 73322055 missense probably damaging 0.97
IGL03113:Capn13 APN 17 73331113 missense probably benign 0.00
IGL03246:Capn13 APN 17 73382860 missense probably benign
IGL03369:Capn13 APN 17 73341154 splice site probably benign
R0116:Capn13 UTSW 17 73351524 missense probably damaging 1.00
R0729:Capn13 UTSW 17 73322069 missense probably damaging 1.00
R0746:Capn13 UTSW 17 73351508 missense probably benign 0.39
R0778:Capn13 UTSW 17 73351508 missense probably benign 0.39
R1252:Capn13 UTSW 17 73367227 missense possibly damaging 0.80
R1594:Capn13 UTSW 17 73351479 missense probably benign 0.15
R1641:Capn13 UTSW 17 73382894 missense possibly damaging 0.91
R1895:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R1902:Capn13 UTSW 17 73326361 missense probably damaging 1.00
R1946:Capn13 UTSW 17 73350525 missense possibly damaging 0.50
R2184:Capn13 UTSW 17 73365948 missense probably damaging 1.00
R2427:Capn13 UTSW 17 73326317 splice site probably benign
R2963:Capn13 UTSW 17 73315263 critical splice donor site probably null
R3755:Capn13 UTSW 17 73331119 nonsense probably null
R3759:Capn13 UTSW 17 73322077 missense probably benign 0.01
R3795:Capn13 UTSW 17 73337392 missense probably benign 0.14
R3801:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3802:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3803:Capn13 UTSW 17 73339401 missense probably benign 0.00
R3804:Capn13 UTSW 17 73339401 missense probably benign 0.00
R4084:Capn13 UTSW 17 73337449 missense probably benign 0.00
R4194:Capn13 UTSW 17 73339484 missense possibly damaging 0.48
R4326:Capn13 UTSW 17 73331108 missense probably benign
R4788:Capn13 UTSW 17 73337432 nonsense probably null
R4852:Capn13 UTSW 17 73351506 frame shift probably null
R4853:Capn13 UTSW 17 73351506 frame shift probably null
R4855:Capn13 UTSW 17 73351506 frame shift probably null
R5063:Capn13 UTSW 17 73322079 nonsense probably null
R5112:Capn13 UTSW 17 73351506 frame shift probably null
R5438:Capn13 UTSW 17 73326484 missense probably benign
R5955:Capn13 UTSW 17 73331002 missense possibly damaging 0.92
R6408:Capn13 UTSW 17 73365959 nonsense probably null
R6512:Capn13 UTSW 17 73382990 missense probably benign 0.44
R7425:Capn13 UTSW 17 73318058 missense probably benign 0.13
R7605:Capn13 UTSW 17 73345137 critical splice donor site probably null
R7678:Capn13 UTSW 17 73315305 missense probably damaging 1.00
R7776:Capn13 UTSW 17 73322054 missense probably benign 0.07
R7791:Capn13 UTSW 17 73382888 missense possibly damaging 0.88
R8087:Capn13 UTSW 17 73316284 missense probably damaging 1.00
R8090:Capn13 UTSW 17 73382854 missense probably benign 0.07
R8122:Capn13 UTSW 17 73367210 missense probably damaging 1.00
R8169:Capn13 UTSW 17 73326472 splice site probably null
Z1176:Capn13 UTSW 17 73341110 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAATCCCTGCCTCAGAGAGAAG -3'
(R):5'- TTTTCAGACCAAGGAGGGAGCAAC -3'

Sequencing Primer
(F):5'- CTGCCTCAGAGAGAAGATACATATGG -3'
(R):5'- GGAGCAACAAAGCAGATTCTTATC -3'
Posted On2013-09-30