Incidental Mutation 'R9372:Gipr'
ID 709383
Institutional Source Beutler Lab
Gene Symbol Gipr
Ensembl Gene ENSMUSG00000030406
Gene Name gastric inhibitory polypeptide receptor
Synonyms LOC381853, LOC232937, glucose-dependent insulinotropic polypeptide receptor
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R9372 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 18889986-18900052 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18896863 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 136 (M136L)
Ref Sequence ENSEMBL: ENSMUSP00000092384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094790] [ENSMUST00000206971]
AlphaFold Q0P543
Predicted Effect probably benign
Transcript: ENSMUST00000094790
AA Change: M136L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092384
Gene: ENSMUSG00000030406
AA Change: M136L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
HormR 53 123 6.14e-23 SMART
Pfam:7tm_2 130 384 1.3e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206971
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor for gastric inhibitory polypeptide (GIP), which was originally identified as an activity in gut extracts that inhibited gastric acid secretion and gastrin release, but subsequently was demonstrated to stimulate insulin release in the presence of elevated glucose. Mice lacking this gene exhibit higher blood glucose levels with impaired initial insulin response after oral glucose load. Defect in this gene thus may contribute to the pathogenesis of diabetes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this gene results in mild glucose intolerance due to impaired glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
Aass T C 6: 23,078,856 (GRCm39) T719A probably damaging Het
Abcb8 A G 5: 24,605,114 (GRCm39) E100G probably benign Het
Actr1b C T 1: 36,741,561 (GRCm39) E104K probably damaging Het
Atad5 T A 11: 79,985,094 (GRCm39) S60R possibly damaging Het
Bcan G T 3: 87,895,610 (GRCm39) A842D probably benign Het
Cacna2d2 G A 9: 107,394,802 (GRCm39) E623K probably benign Het
Cdk15 T C 1: 59,370,142 (GRCm39) Y393H probably benign Het
Ceacam12 C T 7: 17,803,229 (GRCm39) R212C probably benign Het
Ceacam5 T C 7: 17,481,267 (GRCm39) I338T possibly damaging Het
Crcp A G 5: 130,088,664 (GRCm39) D139G possibly damaging Het
Crls1 T A 2: 132,707,802 (GRCm39) Y290* probably null Het
Dcun1d5 A G 9: 7,206,780 (GRCm39) N206D probably damaging Het
Dmtf1 A T 5: 9,190,399 (GRCm39) V105E possibly damaging Het
Dnah7a T C 1: 53,543,474 (GRCm39) Y2232C probably benign Het
Dnajc25 T A 4: 59,003,394 (GRCm39) V55E probably damaging Het
Dpy19l4 T C 4: 11,303,343 (GRCm39) M193V possibly damaging Het
Dsc1 A T 18: 20,221,489 (GRCm39) V662E probably damaging Het
Enpp6 G A 8: 47,506,627 (GRCm39) V144I possibly damaging Het
Fip1l1 A G 5: 74,707,463 (GRCm39) T204A possibly damaging Het
Flvcr2 T C 12: 85,793,795 (GRCm39) V57A probably benign Het
Fsip2 T G 2: 82,822,756 (GRCm39) I6163S possibly damaging Het
Gm7298 A G 6: 121,748,746 (GRCm39) I674V probably benign Het
Gtf2a1 C T 12: 91,534,592 (GRCm39) V221I probably damaging Het
Haus3 A T 5: 34,321,002 (GRCm39) D481E probably benign Het
Hinfp A C 9: 44,209,083 (GRCm39) V345G probably damaging Het
Hs3st5 A T 10: 36,708,698 (GRCm39) K78* probably null Het
Ighv1-31 T C 12: 114,792,894 (GRCm39) Y114C probably damaging Het
Ighv5-15 T A 12: 113,790,357 (GRCm39) T88S probably damaging Het
Ildr1 G A 16: 36,542,721 (GRCm39) D418N probably damaging Het
Ints10 C T 8: 69,271,967 (GRCm39) T556I probably damaging Het
Isoc1 G T 18: 58,792,757 (GRCm39) R65L possibly damaging Het
Itm2c C T 1: 85,833,055 (GRCm39) R130C probably damaging Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Kif11 T C 19: 37,399,892 (GRCm39) V793A probably benign Het
Klrg1 A C 6: 122,256,699 (GRCm39) V29G probably benign Het
Lrch4 A G 5: 137,631,953 (GRCm39) T114A possibly damaging Het
Map3k3 C T 11: 106,033,335 (GRCm39) T196M probably damaging Het
Marchf1 C A 8: 66,921,145 (GRCm39) T274N probably benign Het
Nxpe5 A T 5: 138,249,445 (GRCm39) T412S probably benign Het
Or10q1 C T 19: 13,727,069 (GRCm39) H200Y probably benign Het
Pcnt A G 10: 76,258,960 (GRCm39) W502R probably damaging Het
Pfdn5 T C 15: 102,235,286 (GRCm39) probably null Het
Pkn2 A T 3: 142,535,018 (GRCm39) V232E probably damaging Het
Ppfibp1 T C 6: 146,898,307 (GRCm39) S88P probably damaging Het
Prr23a4 A G 9: 98,785,478 (GRCm39) I48V probably benign Het
Ptprz1 G A 6: 23,045,706 (GRCm39) E2159K probably damaging Het
Smyd3 T C 1: 178,871,470 (GRCm39) E303G possibly damaging Het
Snx13 T A 12: 35,151,048 (GRCm39) N336K possibly damaging Het
Src A G 2: 157,311,808 (GRCm39) E512G possibly damaging Het
Stard9 T A 2: 120,495,420 (GRCm39) C98* probably null Het
Tapbpl A G 6: 125,203,672 (GRCm39) V336A probably benign Het
Tbrg1 G A 9: 37,563,945 (GRCm39) T230I probably damaging Het
Tm7sf3 C T 6: 146,525,179 (GRCm39) D89N possibly damaging Het
Tmem132c G A 5: 127,640,145 (GRCm39) G772D probably damaging Het
Tmem219 C T 7: 126,496,017 (GRCm39) G119S possibly damaging Het
Ttbk2 T A 2: 120,603,766 (GRCm39) S325C probably benign Het
Ttc28 A T 5: 111,331,073 (GRCm39) Y431F probably benign Het
Vmn1r27 A T 6: 58,192,746 (GRCm39) M86K possibly damaging Het
Vmn2r15 G A 5: 109,441,953 (GRCm39) P160L possibly damaging Het
Zfc3h1 A T 10: 115,221,223 (GRCm39) S41C unknown Het
Zfp260 C A 7: 29,804,232 (GRCm39) T44K probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Zfp760 A G 17: 21,941,035 (GRCm39) N70S probably benign Het
Zfp788 T A 7: 41,299,708 (GRCm39) Y781* probably null Het
Zfp800 A T 6: 28,256,433 (GRCm39) S52T possibly damaging Het
Other mutations in Gipr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Gipr APN 7 18,893,431 (GRCm39) unclassified probably benign
IGL02214:Gipr APN 7 18,891,471 (GRCm39) missense possibly damaging 0.46
IGL02525:Gipr APN 7 18,893,690 (GRCm39) missense possibly damaging 0.64
IGL03163:Gipr APN 7 18,896,481 (GRCm39) nonsense probably null
PIT4449001:Gipr UTSW 7 18,894,543 (GRCm39) missense probably benign 0.05
PIT4480001:Gipr UTSW 7 18,896,859 (GRCm39) missense probably damaging 1.00
R1813:Gipr UTSW 7 18,897,996 (GRCm39) missense probably benign 0.02
R1896:Gipr UTSW 7 18,897,996 (GRCm39) missense probably benign 0.02
R3409:Gipr UTSW 7 18,893,719 (GRCm39) missense possibly damaging 0.74
R3949:Gipr UTSW 7 18,891,354 (GRCm39) missense probably benign 0.00
R4781:Gipr UTSW 7 18,891,300 (GRCm39) missense possibly damaging 0.95
R4841:Gipr UTSW 7 18,896,601 (GRCm39) missense probably damaging 1.00
R4842:Gipr UTSW 7 18,896,601 (GRCm39) missense probably damaging 1.00
R5087:Gipr UTSW 7 18,893,689 (GRCm39) missense probably damaging 1.00
R5297:Gipr UTSW 7 18,891,469 (GRCm39) missense probably damaging 1.00
R5480:Gipr UTSW 7 18,894,579 (GRCm39) missense probably damaging 1.00
R5763:Gipr UTSW 7 18,897,475 (GRCm39) missense probably damaging 0.99
R6957:Gipr UTSW 7 18,898,529 (GRCm39) missense probably benign 0.01
R7035:Gipr UTSW 7 18,896,809 (GRCm39) missense probably damaging 1.00
R7254:Gipr UTSW 7 18,897,538 (GRCm39) missense probably damaging 1.00
R7720:Gipr UTSW 7 18,896,884 (GRCm39) missense probably benign 0.02
R8234:Gipr UTSW 7 18,898,533 (GRCm39) missense unknown
R9098:Gipr UTSW 7 18,897,495 (GRCm39) missense unknown
R9776:Gipr UTSW 7 18,891,487 (GRCm39) missense probably damaging 0.96
Z1177:Gipr UTSW 7 18,891,490 (GRCm39) missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AATTACGAGTGCAGTGCAGCC -3'
(R):5'- AGCGCCTGTTTGGAGAGAAG -3'

Sequencing Primer
(F):5'- TGAAAAGCTGTCCTCAGGC -3'
(R):5'- CTGTTTGGAGAGAAGGAACATTTTTC -3'
Posted On 2022-04-18