Incidental Mutation 'R9372:Gipr'
ID 709383
Institutional Source Beutler Lab
Gene Symbol Gipr
Ensembl Gene ENSMUSG00000030406
Gene Name gastric inhibitory polypeptide receptor
Synonyms LOC232937, glucose-dependent insulinotropic polypeptide receptor, LOC381853
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock # R9372 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 19156061-19166127 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19162938 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 136 (M136L)
Ref Sequence ENSEMBL: ENSMUSP00000092384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094790] [ENSMUST00000206971]
AlphaFold Q0P543
Predicted Effect probably benign
Transcript: ENSMUST00000094790
AA Change: M136L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092384
Gene: ENSMUSG00000030406
AA Change: M136L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
HormR 53 123 6.14e-23 SMART
Pfam:7tm_2 130 384 1.3e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206971
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor for gastric inhibitory polypeptide (GIP), which was originally identified as an activity in gut extracts that inhibited gastric acid secretion and gastrin release, but subsequently was demonstrated to stimulate insulin release in the presence of elevated glucose. Mice lacking this gene exhibit higher blood glucose levels with impaired initial insulin response after oral glucose load. Defect in this gene thus may contribute to the pathogenesis of diabetes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this gene results in mild glucose intolerance due to impaired glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
7420426K07Rik A G 9: 98,903,425 I48V probably benign Het
Aass T C 6: 23,078,857 T719A probably damaging Het
Abcb8 A G 5: 24,400,116 E100G probably benign Het
Actr1b C T 1: 36,702,480 E104K probably damaging Het
Atad5 T A 11: 80,094,268 S60R possibly damaging Het
Bcan G T 3: 87,988,303 A842D probably benign Het
Cacna2d2 G A 9: 107,517,603 E623K probably benign Het
Cdk15 T C 1: 59,330,983 Y393H probably benign Het
Ceacam12 C T 7: 18,069,304 R212C probably benign Het
Ceacam5 T C 7: 17,747,342 I338T possibly damaging Het
Crcp A G 5: 130,059,823 D139G possibly damaging Het
Crls1 T A 2: 132,865,882 Y290* probably null Het
Dcun1d5 A G 9: 7,206,780 N206D probably damaging Het
Dmtf1 A T 5: 9,140,399 V105E possibly damaging Het
Dnah7a T C 1: 53,504,315 Y2232C probably benign Het
Dnajc25 T A 4: 59,003,394 V55E probably damaging Het
Dpy19l4 T C 4: 11,303,343 M193V possibly damaging Het
Dsc1 A T 18: 20,088,432 V662E probably damaging Het
Enpp6 G A 8: 47,053,592 V144I possibly damaging Het
Fip1l1 A G 5: 74,546,802 T204A possibly damaging Het
Flvcr2 T C 12: 85,747,021 V57A probably benign Het
Fsip2 T G 2: 82,992,412 I6163S possibly damaging Het
Gm7298 A G 6: 121,771,787 I674V probably benign Het
Gtf2a1 C T 12: 91,567,818 V221I probably damaging Het
Haus3 A T 5: 34,163,658 D481E probably benign Het
Hinfp A C 9: 44,297,786 V345G probably damaging Het
Hs3st5 A T 10: 36,832,702 K78* probably null Het
Ighv1-31 T C 12: 114,829,274 Y114C probably damaging Het
Ighv5-15 T A 12: 113,826,737 T88S probably damaging Het
Ildr1 G A 16: 36,722,359 D418N probably damaging Het
Ints10 C T 8: 68,819,315 T556I probably damaging Het
Isoc1 G T 18: 58,659,685 R65L possibly damaging Het
Itm2c C T 1: 85,905,334 R130C probably damaging Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Kif11 T C 19: 37,411,444 V793A probably benign Het
Klrg1 A C 6: 122,279,740 V29G probably benign Het
Lrch4 A G 5: 137,633,691 T114A possibly damaging Het
Map3k3 C T 11: 106,142,509 T196M probably damaging Het
March1 C A 8: 66,468,493 T274N probably benign Het
Nxpe5 A T 5: 138,251,183 T412S probably benign Het
Olfr1494 C T 19: 13,749,705 H200Y probably benign Het
Pcnt A G 10: 76,423,126 W502R probably damaging Het
Pfdn5 T C 15: 102,326,851 probably null Het
Pkn2 A T 3: 142,829,257 V232E probably damaging Het
Ppfibp1 T C 6: 146,996,809 S88P probably damaging Het
Ptprz1 G A 6: 23,045,707 E2159K probably damaging Het
Smyd3 T C 1: 179,043,905 E303G possibly damaging Het
Snx13 T A 12: 35,101,049 N336K possibly damaging Het
Src A G 2: 157,469,888 E512G possibly damaging Het
Stard9 T A 2: 120,664,939 C98* probably null Het
Tapbpl A G 6: 125,226,709 V336A probably benign Het
Tbrg1 G A 9: 37,652,649 T230I probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem132c G A 5: 127,563,081 G772D probably damaging Het
Tmem219 C T 7: 126,896,845 G119S possibly damaging Het
Ttbk2 T A 2: 120,773,285 S325C probably benign Het
Ttc28 A T 5: 111,183,207 Y431F probably benign Het
Vmn1r27 A T 6: 58,215,761 M86K possibly damaging Het
Vmn2r15 G A 5: 109,294,087 P160L possibly damaging Het
Zfc3h1 A T 10: 115,385,318 S41C unknown Het
Zfp260 C A 7: 30,104,807 T44K probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Zfp760 A G 17: 21,722,054 N70S probably benign Het
Zfp788 T A 7: 41,650,284 Y781* probably null Het
Zfp800 A T 6: 28,256,434 S52T possibly damaging Het
Other mutations in Gipr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Gipr APN 7 19159506 unclassified probably benign
IGL02214:Gipr APN 7 19157546 missense possibly damaging 0.46
IGL02525:Gipr APN 7 19159765 missense possibly damaging 0.64
IGL03163:Gipr APN 7 19162556 nonsense probably null
PIT4449001:Gipr UTSW 7 19160618 missense probably benign 0.05
PIT4480001:Gipr UTSW 7 19162934 missense probably damaging 1.00
R1813:Gipr UTSW 7 19164071 missense probably benign 0.02
R1896:Gipr UTSW 7 19164071 missense probably benign 0.02
R3409:Gipr UTSW 7 19159794 missense possibly damaging 0.74
R3949:Gipr UTSW 7 19157429 missense probably benign 0.00
R4781:Gipr UTSW 7 19157375 missense possibly damaging 0.95
R4841:Gipr UTSW 7 19162676 missense probably damaging 1.00
R4842:Gipr UTSW 7 19162676 missense probably damaging 1.00
R5087:Gipr UTSW 7 19159764 missense probably damaging 1.00
R5297:Gipr UTSW 7 19157544 missense probably damaging 1.00
R5480:Gipr UTSW 7 19160654 missense probably damaging 1.00
R5763:Gipr UTSW 7 19163550 missense probably damaging 0.99
R6957:Gipr UTSW 7 19164604 missense probably benign 0.01
R7035:Gipr UTSW 7 19162884 missense probably damaging 1.00
R7254:Gipr UTSW 7 19163613 missense probably damaging 1.00
R7720:Gipr UTSW 7 19162959 missense probably benign 0.02
R8234:Gipr UTSW 7 19164608 missense unknown
R9098:Gipr UTSW 7 19163570 missense unknown
R9776:Gipr UTSW 7 19157562 missense probably damaging 0.96
Z1177:Gipr UTSW 7 19157565 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AATTACGAGTGCAGTGCAGCC -3'
(R):5'- AGCGCCTGTTTGGAGAGAAG -3'

Sequencing Primer
(F):5'- TGAAAAGCTGTCCTCAGGC -3'
(R):5'- CTGTTTGGAGAGAAGGAACATTTTTC -3'
Posted On 2022-04-18