Incidental Mutation 'R9373:Helz2'
ID 709423
Institutional Source Beutler Lab
Gene Symbol Helz2
Ensembl Gene ENSMUSG00000027580
Gene Name helicase with zinc finger 2, transcriptional coactivator
Synonyms BC006779
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9373 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 181227615-181242027 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 181240948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 17 (N17K)
Ref Sequence ENSEMBL: ENSMUSP00000091756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094203] [ENSMUST00000108831] [ENSMUST00000121484]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094203
AA Change: N17K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091756
Gene: ENSMUSG00000027580
AA Change: N17K

low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108831
AA Change: N17K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104459
Gene: ENSMUSG00000027580
AA Change: N17K

low complexity region 509 517 N/A INTRINSIC
AAA 782 973 1.41e-2 SMART
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
AAA 2462 2713 1.48e0 SMART
SCOP:d1pjr_2 2793 2838 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121484
AA Change: N17K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112917
Gene: ENSMUSG00000027580
AA Change: N17K

low complexity region 509 517 N/A INTRINSIC
Pfam:AAA_11 761 877 3.9e-10 PFAM
Pfam:AAA_19 780 849 1.7e-7 PFAM
Pfam:AAA_11 870 952 2e-15 PFAM
Pfam:AAA_12 958 1162 3.8e-26 PFAM
low complexity region 1238 1263 N/A INTRINSIC
low complexity region 1284 1291 N/A INTRINSIC
RNB 1567 1924 2.45e-87 SMART
low complexity region 2056 2067 N/A INTRINSIC
low complexity region 2242 2259 N/A INTRINSIC
Pfam:AAA_11 2400 2653 4e-42 PFAM
Pfam:AAA_12 2660 2866 2e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear transcriptional co-activator for peroxisome proliferator activated receptor alpha. The encoded protein contains a zinc finger and is a helicase that appears to be part of the peroxisome proliferator activated receptor alpha interacting complex. This gene is a member of the DNA2/NAM7 helicase gene family. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit slower weight gain, hyperleptinemia, increased oxygen consumption, decreased respiratory quotient, decreased liver triglyceride level and ameliorated hyperlipidemia and hepatosteatosis when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A C 5: 87,972,809 D475A probably benign Het
3110043O21Rik A G 4: 35,196,985 F360S Het
Aatk T C 11: 120,015,517 M243V possibly damaging Het
Acox1 A T 11: 116,174,347 N627K possibly damaging Het
Adal A G 2: 121,150,222 Y142C probably benign Het
Agfg2 A G 5: 137,664,214 probably null Het
Ajap1 C T 4: 153,432,213 A224T probably benign Het
Alg1 T C 16: 5,239,126 F234L probably benign Het
Arhgap27 G T 11: 103,360,461 A147E possibly damaging Het
Cachd1 T C 4: 100,974,870 V743A possibly damaging Het
Cc2d2b G A 19: 40,795,723 V655I unknown Het
Cd72 T C 4: 43,450,141 S256G possibly damaging Het
Celf2 G T 2: 6,547,104 N521K probably benign Het
Clca4a T A 3: 144,966,372 N270Y possibly damaging Het
Clvs2 A T 10: 33,528,386 V278E probably benign Het
Cwf19l2 T C 9: 3,454,718 F677S probably damaging Het
Dyx1c1 A G 9: 72,964,180 T241A probably damaging Het
Epdr1 T C 13: 19,594,537 N130D possibly damaging Het
Fam184a G A 10: 53,690,019 R491W probably benign Het
Fam71e2 T C 7: 4,757,713 M667V Het
Foxp2 A G 6: 15,377,970 Q160R unknown Het
Fstl5 T A 3: 76,648,362 Y515* probably null Het
Jmjd1c C T 10: 67,096,716 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Lrrn1 A C 6: 107,568,504 Q421P possibly damaging Het
Mapk1 A G 16: 17,018,290 I101V probably benign Het
Me2 T C 18: 73,785,729 E427G probably damaging Het
Mrc1 G A 2: 14,270,188 M433I probably damaging Het
Mrvi1 A G 7: 110,945,831 probably null Het
Nelfb G A 2: 25,205,206 R324W probably damaging Het
Nlrp4b T A 7: 10,715,199 I443K probably benign Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr1012 A T 2: 85,759,931 Y148* probably null Het
Olfr1474 A G 19: 13,471,852 E294G probably damaging Het
Olfr877 T A 9: 37,855,454 V212D probably damaging Het
Olfr914 G A 9: 38,606,846 C127Y possibly damaging Het
Parvb C T 15: 84,303,899 T281I probably damaging Het
Prune2 A G 19: 17,122,138 T1669A probably benign Het
Runx3 A G 4: 135,121,145 T14A probably benign Het
Scn9a A G 2: 66,483,917 V1819A probably benign Het
Senp1 T C 15: 98,066,554 T260A probably benign Het
Serpinb10 A G 1: 107,547,019 R304G possibly damaging Het
Spem1 C T 11: 69,821,814 C65Y probably benign Het
Tdrd6 A G 17: 43,628,162 V665A possibly damaging Het
Tenm2 C T 11: 36,039,886 A1772T probably damaging Het
Tenm3 C T 8: 48,299,655 V891I probably damaging Het
Trank1 A G 9: 111,365,191 D761G probably benign Het
Ubap2l A T 3: 90,008,280 Y985N unknown Het
Vwc2l A T 1: 70,729,059 H94L probably damaging Het
Wdr27 G A 17: 14,934,533 H41Y probably benign Het
Zcchc6 T C 13: 59,796,867 S1053G probably damaging Het
Zfp7 AGTGCGGGAAAGGTTTCCACCTG AG 15: 76,890,598 probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Other mutations in Helz2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Helz2 APN 2 181229702 missense probably damaging 1.00
IGL00515:Helz2 APN 2 181233006 nonsense probably null
IGL00704:Helz2 APN 2 181234385 missense probably damaging 1.00
IGL00847:Helz2 APN 2 181232245 missense possibly damaging 0.73
IGL01448:Helz2 APN 2 181233977 missense probably damaging 1.00
IGL01783:Helz2 APN 2 181232881 missense probably damaging 1.00
IGL01790:Helz2 APN 2 181238481 missense probably benign 0.29
IGL02116:Helz2 APN 2 181232185 missense probably damaging 1.00
IGL02226:Helz2 APN 2 181231690 missense probably damaging 1.00
IGL02402:Helz2 APN 2 181230911 missense probably damaging 1.00
IGL02403:Helz2 APN 2 181231022 missense probably damaging 1.00
IGL02733:Helz2 APN 2 181235026 missense probably benign 0.14
IGL02869:Helz2 APN 2 181231146 intron probably benign
IGL03003:Helz2 APN 2 181240253 missense probably damaging 1.00
IGL03060:Helz2 APN 2 181229222 critical splice donor site probably null
IGL03310:Helz2 APN 2 181231804 missense probably benign 0.00
Colby UTSW 2 181233202 missense probably damaging 1.00
ANU74:Helz2 UTSW 2 181234834 missense probably benign 0.03
R0013:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0013:Helz2 UTSW 2 181240959 missense probably benign
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0014:Helz2 UTSW 2 181240511 missense probably damaging 1.00
R0016:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0018:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0019:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0055:Helz2 UTSW 2 181228821 missense possibly damaging 0.47
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0071:Helz2 UTSW 2 181236407 missense probably damaging 1.00
R0111:Helz2 UTSW 2 181237802 missense probably benign 0.30
R0117:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0135:Helz2 UTSW 2 181232269 missense probably damaging 1.00
R0194:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0242:Helz2 UTSW 2 181230430 missense probably damaging 1.00
R0254:Helz2 UTSW 2 181232759 missense probably damaging 1.00
R0410:Helz2 UTSW 2 181230593 missense probably damaging 1.00
R0442:Helz2 UTSW 2 181232209 missense probably damaging 0.97
R0497:Helz2 UTSW 2 181229656 missense probably damaging 0.97
R0517:Helz2 UTSW 2 181227770 missense probably benign 0.00
R0541:Helz2 UTSW 2 181234825 missense possibly damaging 0.89
R0542:Helz2 UTSW 2 181232089 missense probably damaging 1.00
R0591:Helz2 UTSW 2 181232116 missense probably damaging 0.96
R0692:Helz2 UTSW 2 181240881 missense probably benign
R0826:Helz2 UTSW 2 181240853 missense possibly damaging 0.51
R0834:Helz2 UTSW 2 181230777 missense probably damaging 1.00
R0880:Helz2 UTSW 2 181236135 missense probably benign
R1170:Helz2 UTSW 2 181229815 missense probably damaging 1.00
R1186:Helz2 UTSW 2 181231128 missense probably damaging 1.00
R1344:Helz2 UTSW 2 181237596 missense possibly damaging 0.89
R1358:Helz2 UTSW 2 181232981 missense probably damaging 1.00
R1436:Helz2 UTSW 2 181235524 missense probably damaging 0.99
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1464:Helz2 UTSW 2 181239654 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1466:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1477:Helz2 UTSW 2 181232804 missense probably benign 0.00
R1564:Helz2 UTSW 2 181233228 missense probably benign 0.01
R1584:Helz2 UTSW 2 181236297 missense probably damaging 1.00
R1655:Helz2 UTSW 2 181234147 missense probably damaging 0.99
R1757:Helz2 UTSW 2 181236263 missense probably damaging 1.00
R1779:Helz2 UTSW 2 181234987 missense probably benign
R1779:Helz2 UTSW 2 181238459 missense possibly damaging 0.84
R1837:Helz2 UTSW 2 181229289 missense probably damaging 1.00
R1845:Helz2 UTSW 2 181232085 missense probably benign 0.02
R1894:Helz2 UTSW 2 181234289 missense probably damaging 1.00
R1913:Helz2 UTSW 2 181233750 missense probably damaging 1.00
R2005:Helz2 UTSW 2 181231329 missense probably benign 0.45
R2034:Helz2 UTSW 2 181232578 missense probably damaging 1.00
R2036:Helz2 UTSW 2 181237479 missense probably benign 0.03
R2061:Helz2 UTSW 2 181240544 missense probably damaging 1.00
R2088:Helz2 UTSW 2 181235102 missense probably benign 0.07
R2142:Helz2 UTSW 2 181231380 missense probably benign
R2180:Helz2 UTSW 2 181233732 missense probably damaging 1.00
R2192:Helz2 UTSW 2 181229048 nonsense probably null
R2248:Helz2 UTSW 2 181233433 missense probably benign 0.33
R2495:Helz2 UTSW 2 181232912 missense probably damaging 0.99
R2886:Helz2 UTSW 2 181240742 missense probably benign
R3617:Helz2 UTSW 2 181233061 missense probably damaging 1.00
R3776:Helz2 UTSW 2 181240389 nonsense probably null
R3803:Helz2 UTSW 2 181239996 missense probably damaging 0.96
R4043:Helz2 UTSW 2 181229710 missense probably benign 0.00
R4052:Helz2 UTSW 2 181240475 missense probably damaging 1.00
R4232:Helz2 UTSW 2 181229902 missense probably damaging 1.00
R4521:Helz2 UTSW 2 181228833 missense probably benign
R4624:Helz2 UTSW 2 181239308 missense probably damaging 0.99
R4720:Helz2 UTSW 2 181238417 missense probably damaging 1.00
R4831:Helz2 UTSW 2 181237417 missense probably damaging 1.00
R4852:Helz2 UTSW 2 181230120 missense probably damaging 1.00
R4894:Helz2 UTSW 2 181236147 missense probably benign 0.01
R4915:Helz2 UTSW 2 181232438 missense possibly damaging 0.80
R4965:Helz2 UTSW 2 181240916 missense possibly damaging 0.79
R5022:Helz2 UTSW 2 181240569 missense probably benign
R5089:Helz2 UTSW 2 181235149 missense probably benign 0.14
R5190:Helz2 UTSW 2 181230757 critical splice donor site probably null
R5309:Helz2 UTSW 2 181234846 missense probably benign 0.08
R5358:Helz2 UTSW 2 181235528 missense probably damaging 1.00
R5379:Helz2 UTSW 2 181235069 missense probably benign
R5559:Helz2 UTSW 2 181230126 missense probably damaging 0.98
R5591:Helz2 UTSW 2 181240258 missense probably damaging 0.99
R5596:Helz2 UTSW 2 181237289 intron probably benign
R5805:Helz2 UTSW 2 181240508 missense probably damaging 1.00
R5823:Helz2 UTSW 2 181236396 missense possibly damaging 0.92
R5825:Helz2 UTSW 2 181232656 missense probably benign 0.02
R5873:Helz2 UTSW 2 181234028 missense possibly damaging 0.78
R5928:Helz2 UTSW 2 181230384 missense possibly damaging 0.82
R5936:Helz2 UTSW 2 181230767 missense probably damaging 1.00
R5975:Helz2 UTSW 2 181231050 missense probably benign 0.08
R6045:Helz2 UTSW 2 181240313 missense probably benign 0.03
R6077:Helz2 UTSW 2 181233038 missense probably benign 0.41
R6218:Helz2 UTSW 2 181232294 missense probably benign 0.03
R6218:Helz2 UTSW 2 181235945 missense probably damaging 1.00
R6315:Helz2 UTSW 2 181233202 missense probably damaging 1.00
R6346:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6371:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6372:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6373:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6385:Helz2 UTSW 2 181233467 missense probably damaging 1.00
R6464:Helz2 UTSW 2 181235069 missense probably benign
R6581:Helz2 UTSW 2 181229379 missense probably damaging 0.99
R6651:Helz2 UTSW 2 181239557 nonsense probably null
R6964:Helz2 UTSW 2 181230428 missense probably damaging 1.00
R7061:Helz2 UTSW 2 181240514 missense probably damaging 1.00
R7153:Helz2 UTSW 2 181231285 missense probably benign 0.00
R7372:Helz2 UTSW 2 181238423 missense possibly damaging 0.61
R7512:Helz2 UTSW 2 181230854 missense probably benign 0.00
R7512:Helz2 UTSW 2 181235600 splice site probably null
R7583:Helz2 UTSW 2 181237572 missense probably benign 0.06
R7724:Helz2 UTSW 2 181231996 missense probably damaging 1.00
R7733:Helz2 UTSW 2 181230355 missense possibly damaging 0.63
R7748:Helz2 UTSW 2 181234531 missense probably damaging 1.00
R7774:Helz2 UTSW 2 181233991 missense probably benign
R7799:Helz2 UTSW 2 181237989 missense probably benign 0.15
R7841:Helz2 UTSW 2 181232902 missense probably damaging 1.00
R7939:Helz2 UTSW 2 181237750 missense probably damaging 0.99
R8026:Helz2 UTSW 2 181240205 missense probably benign 0.34
R8030:Helz2 UTSW 2 181237896 missense possibly damaging 0.55
R8080:Helz2 UTSW 2 181238262 missense probably damaging 0.99
R8237:Helz2 UTSW 2 181229331 missense possibly damaging 0.65
R8245:Helz2 UTSW 2 181238102 missense probably damaging 1.00
R8304:Helz2 UTSW 2 181230157 missense probably benign 0.03
R8486:Helz2 UTSW 2 181229331 missense probably damaging 1.00
R8556:Helz2 UTSW 2 181229557 missense probably damaging 1.00
R8878:Helz2 UTSW 2 181232767 missense possibly damaging 0.67
R8907:Helz2 UTSW 2 181233127 missense possibly damaging 0.47
R8911:Helz2 UTSW 2 181238380 missense
R8953:Helz2 UTSW 2 181233091 missense probably damaging 1.00
R8963:Helz2 UTSW 2 181229614 missense probably damaging 1.00
R8969:Helz2 UTSW 2 181237788 missense probably benign 0.19
R8976:Helz2 UTSW 2 181234693 missense possibly damaging 0.46
R9015:Helz2 UTSW 2 181228999 missense probably damaging 1.00
R9031:Helz2 UTSW 2 181232468 missense possibly damaging 0.78
R9052:Helz2 UTSW 2 181240175 missense possibly damaging 0.78
R9089:Helz2 UTSW 2 181239640 missense probably damaging 1.00
R9145:Helz2 UTSW 2 181240055 missense probably damaging 1.00
R9185:Helz2 UTSW 2 181230090 missense probably benign
R9186:Helz2 UTSW 2 181234664 missense possibly damaging 0.57
R9407:Helz2 UTSW 2 181240182 missense probably benign 0.01
R9465:Helz2 UTSW 2 181232917 missense probably benign 0.01
R9502:Helz2 UTSW 2 181236452 missense possibly damaging 0.47
R9538:Helz2 UTSW 2 181240221 missense probably damaging 1.00
R9554:Helz2 UTSW 2 181240677 missense probably damaging 0.96
R9659:Helz2 UTSW 2 181240232 missense probably benign 0.00
R9800:Helz2 UTSW 2 181240823 missense probably damaging 0.99
X0064:Helz2 UTSW 2 181231741 missense probably damaging 1.00
Z1176:Helz2 UTSW 2 181237564 missense probably benign 0.39
Z1177:Helz2 UTSW 2 181235961 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2022-04-18