Incidental Mutation 'R9373:Tdrd6'
ID 709465
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Name tudor domain containing 6
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9373 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 43926226-43941190 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43939053 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 665 (V665A)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000045717
AA Change: V665A

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: V665A

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168073
AA Change: V665A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: V665A

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Meta Mutation Damage Score 0.0674 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2310003L06Rik A C 5: 88,120,668 (GRCm39) D475A probably benign Het
Aatk T C 11: 119,906,343 (GRCm39) M243V possibly damaging Het
Acox1 A T 11: 116,065,173 (GRCm39) N627K possibly damaging Het
Adal A G 2: 120,980,703 (GRCm39) Y142C probably benign Het
Agfg2 A G 5: 137,662,476 (GRCm39) probably null Het
Ajap1 C T 4: 153,516,670 (GRCm39) A224T probably benign Het
Alg1 T C 16: 5,056,990 (GRCm39) F234L probably benign Het
Arhgap27 G T 11: 103,251,287 (GRCm39) A147E possibly damaging Het
C9orf72 A G 4: 35,196,985 (GRCm39) F360S Het
Cachd1 T C 4: 100,832,067 (GRCm39) V743A possibly damaging Het
Cc2d2b G A 19: 40,784,167 (GRCm39) V655I unknown Het
Cd72 T C 4: 43,450,141 (GRCm39) S256G possibly damaging Het
Celf2 G T 2: 6,551,915 (GRCm39) N521K probably benign Het
Clca4a T A 3: 144,672,133 (GRCm39) N270Y possibly damaging Het
Clvs2 A T 10: 33,404,382 (GRCm39) V278E probably benign Het
Cwf19l2 T C 9: 3,454,718 (GRCm39) F677S probably damaging Het
Dnaaf4 A G 9: 72,871,462 (GRCm39) T241A probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Epdr1 T C 13: 19,778,707 (GRCm39) N130D possibly damaging Het
Fam184a G A 10: 53,566,115 (GRCm39) R491W probably benign Het
Foxp2 A G 6: 15,377,969 (GRCm39) Q160R unknown Het
Fstl5 T A 3: 76,555,669 (GRCm39) Y515* probably null Het
Garin5b T C 7: 4,760,712 (GRCm39) M667V Het
Helz2 G T 2: 180,882,741 (GRCm39) N17K probably benign Het
Irag1 A G 7: 110,545,038 (GRCm39) probably null Het
Jmjd1c C T 10: 66,932,495 (GRCm39) probably benign Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Lrrn1 A C 6: 107,545,465 (GRCm39) Q421P possibly damaging Het
Mapk1 A G 16: 16,836,154 (GRCm39) I101V probably benign Het
Me2 T C 18: 73,918,800 (GRCm39) E427G probably damaging Het
Mrc1 G A 2: 14,274,999 (GRCm39) M433I probably damaging Het
Nelfb G A 2: 25,095,218 (GRCm39) R324W probably damaging Het
Nlrp4b T A 7: 10,449,126 (GRCm39) I443K probably benign Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Or5b118 A G 19: 13,449,216 (GRCm39) E294G probably damaging Het
Or8b50 G A 9: 38,518,142 (GRCm39) C127Y possibly damaging Het
Or8b9 T A 9: 37,766,750 (GRCm39) V212D probably damaging Het
Or9g3 A T 2: 85,590,275 (GRCm39) Y148* probably null Het
Parvb C T 15: 84,188,100 (GRCm39) T281I probably damaging Het
Prune2 A G 19: 17,099,502 (GRCm39) T1669A probably benign Het
Runx3 A G 4: 134,848,456 (GRCm39) T14A probably benign Het
Scn9a A G 2: 66,314,261 (GRCm39) V1819A probably benign Het
Senp1 T C 15: 97,964,435 (GRCm39) T260A probably benign Het
Serpinb10 A G 1: 107,474,749 (GRCm39) R304G possibly damaging Het
Spem1 C T 11: 69,712,640 (GRCm39) C65Y probably benign Het
Tenm2 C T 11: 35,930,713 (GRCm39) A1772T probably damaging Het
Tenm3 C T 8: 48,752,690 (GRCm39) V891I probably damaging Het
Trank1 A G 9: 111,194,259 (GRCm39) D761G probably benign Het
Tut7 T C 13: 59,944,681 (GRCm39) S1053G probably damaging Het
Ubap2l A T 3: 89,915,587 (GRCm39) Y985N unknown Het
Vwc2l A T 1: 70,768,218 (GRCm39) H94L probably damaging Het
Wdr27 G A 17: 15,154,795 (GRCm39) H41Y probably benign Het
Zfp7 AGTGCGGGAAAGGTTTCCACCTG AG 15: 76,774,798 (GRCm39) probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43,939,051 (GRCm39) missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43,928,087 (GRCm39) missense probably benign
IGL00845:Tdrd6 APN 17 43,937,607 (GRCm39) missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43,936,659 (GRCm39) missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43,935,657 (GRCm39) missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43,938,871 (GRCm39) missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43,936,065 (GRCm39) missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43,936,837 (GRCm39) missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43,939,100 (GRCm39) missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43,940,242 (GRCm39) missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43,939,281 (GRCm39) missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43,938,093 (GRCm39) missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43,935,629 (GRCm39) missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43,937,728 (GRCm39) missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43,937,110 (GRCm39) missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43,931,337 (GRCm39) missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43,935,918 (GRCm39) missense probably benign
IGL02929:Tdrd6 APN 17 43,940,604 (GRCm39) missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43,938,778 (GRCm39) missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43,938,153 (GRCm39) missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43,938,440 (GRCm39) missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43,936,323 (GRCm39) missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43,936,398 (GRCm39) missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43,938,855 (GRCm39) missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43,936,459 (GRCm39) missense probably damaging 1.00
Edward UTSW 17 43,938,106 (GRCm39) missense probably damaging 1.00
eliza UTSW 17 43,939,053 (GRCm39) missense possibly damaging 0.90
Elizabeth UTSW 17 43,935,095 (GRCm39) missense probably benign 0.00
henry UTSW 17 43,939,050 (GRCm39) missense probably damaging 0.99
BB001:Tdrd6 UTSW 17 43,938,697 (GRCm39) missense possibly damaging 0.94
BB011:Tdrd6 UTSW 17 43,938,697 (GRCm39) missense possibly damaging 0.94
G1citation:Tdrd6 UTSW 17 43,938,106 (GRCm39) missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43,937,482 (GRCm39) missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43,928,052 (GRCm39) splice site probably benign
R0090:Tdrd6 UTSW 17 43,939,132 (GRCm39) missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43,935,199 (GRCm39) missense probably benign
R0463:Tdrd6 UTSW 17 43,936,452 (GRCm39) missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43,940,274 (GRCm39) missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43,939,050 (GRCm39) missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43,937,523 (GRCm39) missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43,937,512 (GRCm39) missense probably benign
R1483:Tdrd6 UTSW 17 43,938,498 (GRCm39) missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43,936,515 (GRCm39) missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43,936,515 (GRCm39) missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43,938,000 (GRCm39) missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43,938,000 (GRCm39) missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43,939,218 (GRCm39) missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43,935,724 (GRCm39) missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43,937,442 (GRCm39) missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43,936,480 (GRCm39) missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43,935,696 (GRCm39) missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43,937,979 (GRCm39) missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43,937,358 (GRCm39) missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43,939,546 (GRCm39) missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43,939,546 (GRCm39) missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43,935,724 (GRCm39) missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43,935,724 (GRCm39) missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43,938,933 (GRCm39) missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43,936,864 (GRCm39) missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43,940,626 (GRCm39) missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43,940,626 (GRCm39) missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43,939,645 (GRCm39) missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43,936,881 (GRCm39) missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43,935,007 (GRCm39) missense probably benign
R4676:Tdrd6 UTSW 17 43,938,501 (GRCm39) missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43,936,467 (GRCm39) missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43,935,218 (GRCm39) missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43,937,101 (GRCm39) missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43,936,966 (GRCm39) missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43,940,224 (GRCm39) missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43,937,299 (GRCm39) missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43,935,768 (GRCm39) missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43,939,302 (GRCm39) missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43,940,373 (GRCm39) missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43,939,788 (GRCm39) missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43,940,643 (GRCm39) missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43,940,643 (GRCm39) missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43,935,411 (GRCm39) missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43,937,229 (GRCm39) missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43,939,852 (GRCm39) missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43,935,423 (GRCm39) missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43,938,106 (GRCm39) missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43,938,599 (GRCm39) missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43,936,065 (GRCm39) missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43,935,095 (GRCm39) missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43,936,984 (GRCm39) missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43,935,937 (GRCm39) missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43,938,817 (GRCm39) missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43,938,570 (GRCm39) missense not run
R7583:Tdrd6 UTSW 17 43,935,129 (GRCm39) missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43,938,817 (GRCm39) missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43,936,851 (GRCm39) missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43,935,730 (GRCm39) missense probably benign 0.00
R7924:Tdrd6 UTSW 17 43,938,697 (GRCm39) missense possibly damaging 0.94
R8002:Tdrd6 UTSW 17 43,940,710 (GRCm39) missense probably damaging 0.98
R8134:Tdrd6 UTSW 17 43,937,064 (GRCm39) missense probably damaging 0.99
R8231:Tdrd6 UTSW 17 43,933,026 (GRCm39) missense probably damaging 1.00
R8242:Tdrd6 UTSW 17 43,939,821 (GRCm39) missense probably damaging 1.00
R8542:Tdrd6 UTSW 17 43,935,783 (GRCm39) missense probably damaging 1.00
R8713:Tdrd6 UTSW 17 43,935,910 (GRCm39) missense probably benign 0.28
R9100:Tdrd6 UTSW 17 43,936,305 (GRCm39) missense possibly damaging 0.76
R9201:Tdrd6 UTSW 17 43,936,561 (GRCm39) missense probably benign 0.00
R9222:Tdrd6 UTSW 17 43,939,231 (GRCm39) missense probably damaging 1.00
R9369:Tdrd6 UTSW 17 43,936,217 (GRCm39) missense probably damaging 1.00
R9384:Tdrd6 UTSW 17 43,937,783 (GRCm39) missense probably benign 0.26
R9448:Tdrd6 UTSW 17 43,936,567 (GRCm39) missense probably benign
R9534:Tdrd6 UTSW 17 43,936,510 (GRCm39) missense probably benign 0.19
R9613:Tdrd6 UTSW 17 43,939,518 (GRCm39) missense probably damaging 0.99
X0065:Tdrd6 UTSW 17 43,936,884 (GRCm39) missense probably damaging 0.99
X0065:Tdrd6 UTSW 17 43,936,044 (GRCm39) missense possibly damaging 0.80
Z1088:Tdrd6 UTSW 17 43,937,409 (GRCm39) missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43,938,078 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCGCCAAAGCTTCTGAAAC -3'
(R):5'- GCTACCGATACTGGCTCTGAAG -3'

Sequencing Primer
(F):5'- CGCCAAAGCTTCTGAAACAGAGAG -3'
(R):5'- ATACTGGCTCTGAAGTGCAC -3'
Posted On 2022-04-18