Incidental Mutation 'R9373:Me2'
ID 709466
Institutional Source Beutler Lab
Gene Symbol Me2
Ensembl Gene ENSMUSG00000024556
Gene Name malic enzyme 2, NAD(+)-dependent, mitochondrial
Synonyms D030040L20Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9373 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 73902974-73948520 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 73918800 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 427 (E427G)
Ref Sequence ENSEMBL: ENSMUSP00000025439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025439]
AlphaFold Q99KE1
Predicted Effect probably damaging
Transcript: ENSMUST00000025439
AA Change: E427G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025439
Gene: ENSMUSG00000024556
AA Change: E427G

DomainStartEndE-ValueType
malic 89 270 3.48e-98 SMART
Malic_M 280 535 2.21e-103 SMART
Meta Mutation Damage Score 0.9350 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial NAD-dependent malic enzyme, a homotetrameric protein, that catalyzes the oxidative decarboxylation of malate to pyruvate. It had previously been weakly linked to a syndrome known as Friedreich ataxia that has since been shown to be the result of mutation in a completely different gene. Certain single-nucleotide polymorphism haplotypes of this gene have been shown to increase the risk for idiopathic generalized epilepsy. Alternatively spliced transcript variants encoding different isoforms found for this gene. [provided by RefSeq, Dec 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2310003L06Rik A C 5: 88,120,668 (GRCm39) D475A probably benign Het
Aatk T C 11: 119,906,343 (GRCm39) M243V possibly damaging Het
Acox1 A T 11: 116,065,173 (GRCm39) N627K possibly damaging Het
Adal A G 2: 120,980,703 (GRCm39) Y142C probably benign Het
Agfg2 A G 5: 137,662,476 (GRCm39) probably null Het
Ajap1 C T 4: 153,516,670 (GRCm39) A224T probably benign Het
Alg1 T C 16: 5,056,990 (GRCm39) F234L probably benign Het
Arhgap27 G T 11: 103,251,287 (GRCm39) A147E possibly damaging Het
C9orf72 A G 4: 35,196,985 (GRCm39) F360S Het
Cachd1 T C 4: 100,832,067 (GRCm39) V743A possibly damaging Het
Cc2d2b G A 19: 40,784,167 (GRCm39) V655I unknown Het
Cd72 T C 4: 43,450,141 (GRCm39) S256G possibly damaging Het
Celf2 G T 2: 6,551,915 (GRCm39) N521K probably benign Het
Clca4a T A 3: 144,672,133 (GRCm39) N270Y possibly damaging Het
Clvs2 A T 10: 33,404,382 (GRCm39) V278E probably benign Het
Cwf19l2 T C 9: 3,454,718 (GRCm39) F677S probably damaging Het
Dnaaf4 A G 9: 72,871,462 (GRCm39) T241A probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Epdr1 T C 13: 19,778,707 (GRCm39) N130D possibly damaging Het
Fam184a G A 10: 53,566,115 (GRCm39) R491W probably benign Het
Foxp2 A G 6: 15,377,969 (GRCm39) Q160R unknown Het
Fstl5 T A 3: 76,555,669 (GRCm39) Y515* probably null Het
Garin5b T C 7: 4,760,712 (GRCm39) M667V Het
Helz2 G T 2: 180,882,741 (GRCm39) N17K probably benign Het
Irag1 A G 7: 110,545,038 (GRCm39) probably null Het
Jmjd1c C T 10: 66,932,495 (GRCm39) probably benign Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Lrrn1 A C 6: 107,545,465 (GRCm39) Q421P possibly damaging Het
Mapk1 A G 16: 16,836,154 (GRCm39) I101V probably benign Het
Mrc1 G A 2: 14,274,999 (GRCm39) M433I probably damaging Het
Nelfb G A 2: 25,095,218 (GRCm39) R324W probably damaging Het
Nlrp4b T A 7: 10,449,126 (GRCm39) I443K probably benign Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Or5b118 A G 19: 13,449,216 (GRCm39) E294G probably damaging Het
Or8b50 G A 9: 38,518,142 (GRCm39) C127Y possibly damaging Het
Or8b9 T A 9: 37,766,750 (GRCm39) V212D probably damaging Het
Or9g3 A T 2: 85,590,275 (GRCm39) Y148* probably null Het
Parvb C T 15: 84,188,100 (GRCm39) T281I probably damaging Het
Prune2 A G 19: 17,099,502 (GRCm39) T1669A probably benign Het
Runx3 A G 4: 134,848,456 (GRCm39) T14A probably benign Het
Scn9a A G 2: 66,314,261 (GRCm39) V1819A probably benign Het
Senp1 T C 15: 97,964,435 (GRCm39) T260A probably benign Het
Serpinb10 A G 1: 107,474,749 (GRCm39) R304G possibly damaging Het
Spem1 C T 11: 69,712,640 (GRCm39) C65Y probably benign Het
Tdrd6 A G 17: 43,939,053 (GRCm39) V665A possibly damaging Het
Tenm2 C T 11: 35,930,713 (GRCm39) A1772T probably damaging Het
Tenm3 C T 8: 48,752,690 (GRCm39) V891I probably damaging Het
Trank1 A G 9: 111,194,259 (GRCm39) D761G probably benign Het
Tut7 T C 13: 59,944,681 (GRCm39) S1053G probably damaging Het
Ubap2l A T 3: 89,915,587 (GRCm39) Y985N unknown Het
Vwc2l A T 1: 70,768,218 (GRCm39) H94L probably damaging Het
Wdr27 G A 17: 15,154,795 (GRCm39) H41Y probably benign Het
Zfp7 AGTGCGGGAAAGGTTTCCACCTG AG 15: 76,774,798 (GRCm39) probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Other mutations in Me2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Me2 APN 18 73,903,713 (GRCm39) missense probably benign 0.01
IGL00977:Me2 APN 18 73,924,248 (GRCm39) missense probably benign 0.24
IGL01161:Me2 APN 18 73,903,887 (GRCm39) splice site probably benign
IGL02351:Me2 APN 18 73,931,038 (GRCm39) missense probably benign 0.20
IGL02358:Me2 APN 18 73,931,038 (GRCm39) missense probably benign 0.20
IGL02647:Me2 APN 18 73,930,974 (GRCm39) missense probably benign 0.00
IGL03172:Me2 APN 18 73,903,797 (GRCm39) missense probably benign
Baako UTSW 18 73,931,016 (GRCm39) missense probably damaging 1.00
excavator UTSW 18 73,914,129 (GRCm39) missense probably damaging 1.00
first_born UTSW 18 73,924,199 (GRCm39) nonsense probably null
muster UTSW 18 73,924,915 (GRCm39) missense probably benign 0.01
powerhouse UTSW 18 73,918,800 (GRCm39) missense probably damaging 1.00
roundup UTSW 18 73,903,744 (GRCm39) missense probably benign
R0018:Me2 UTSW 18 73,924,923 (GRCm39) missense possibly damaging 0.93
R0018:Me2 UTSW 18 73,924,923 (GRCm39) missense possibly damaging 0.93
R0032:Me2 UTSW 18 73,927,596 (GRCm39) missense probably benign
R0119:Me2 UTSW 18 73,903,744 (GRCm39) missense probably benign
R0136:Me2 UTSW 18 73,903,744 (GRCm39) missense probably benign
R0299:Me2 UTSW 18 73,903,744 (GRCm39) missense probably benign
R0657:Me2 UTSW 18 73,903,744 (GRCm39) missense probably benign
R1597:Me2 UTSW 18 73,931,016 (GRCm39) missense probably damaging 1.00
R1638:Me2 UTSW 18 73,906,205 (GRCm39) missense probably benign 0.03
R1765:Me2 UTSW 18 73,924,929 (GRCm39) missense probably damaging 1.00
R1861:Me2 UTSW 18 73,918,785 (GRCm39) missense probably benign 0.11
R2410:Me2 UTSW 18 73,924,183 (GRCm39) missense probably damaging 0.98
R3422:Me2 UTSW 18 73,924,265 (GRCm39) missense probably damaging 0.99
R3954:Me2 UTSW 18 73,914,203 (GRCm39) missense probably damaging 1.00
R3957:Me2 UTSW 18 73,914,203 (GRCm39) missense probably damaging 1.00
R4052:Me2 UTSW 18 73,924,156 (GRCm39) missense probably benign 0.05
R4207:Me2 UTSW 18 73,924,156 (GRCm39) missense probably benign 0.05
R4208:Me2 UTSW 18 73,924,156 (GRCm39) missense probably benign 0.05
R4694:Me2 UTSW 18 73,934,930 (GRCm39) missense probably benign 0.01
R4962:Me2 UTSW 18 73,918,847 (GRCm39) missense probably damaging 1.00
R5527:Me2 UTSW 18 73,924,187 (GRCm39) missense probably damaging 1.00
R6170:Me2 UTSW 18 73,918,852 (GRCm39) missense probably benign 0.07
R6185:Me2 UTSW 18 73,924,199 (GRCm39) nonsense probably null
R6305:Me2 UTSW 18 73,924,915 (GRCm39) missense probably benign 0.01
R6462:Me2 UTSW 18 73,908,470 (GRCm39) missense probably benign 0.17
R7015:Me2 UTSW 18 73,914,218 (GRCm39) splice site probably null
R7085:Me2 UTSW 18 73,914,129 (GRCm39) missense probably damaging 1.00
R7096:Me2 UTSW 18 73,927,961 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCAGAACTGACACACTTACGG -3'
(R):5'- TACCGATACCCGTGGTTTCC -3'

Sequencing Primer
(F):5'- ACTTACGGCAGACTTGGTGACTC -3'
(R):5'- TCAAAGCCATGGCCTCTA -3'
Posted On 2022-04-18