Incidental Mutation 'R9373:Prune2'
ID 709468
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, A330102H22Rik, 6330414G02Rik, Olfaxin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9373 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 16933482-17201296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17099502 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1669 (T1669A)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087689
AA Change: T1669A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: T1669A

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226052
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 28,947,048 (GRCm39) probably benign Het
2310003L06Rik A C 5: 88,120,668 (GRCm39) D475A probably benign Het
Aatk T C 11: 119,906,343 (GRCm39) M243V possibly damaging Het
Acox1 A T 11: 116,065,173 (GRCm39) N627K possibly damaging Het
Adal A G 2: 120,980,703 (GRCm39) Y142C probably benign Het
Agfg2 A G 5: 137,662,476 (GRCm39) probably null Het
Ajap1 C T 4: 153,516,670 (GRCm39) A224T probably benign Het
Alg1 T C 16: 5,056,990 (GRCm39) F234L probably benign Het
Arhgap27 G T 11: 103,251,287 (GRCm39) A147E possibly damaging Het
C9orf72 A G 4: 35,196,985 (GRCm39) F360S Het
Cachd1 T C 4: 100,832,067 (GRCm39) V743A possibly damaging Het
Cc2d2b G A 19: 40,784,167 (GRCm39) V655I unknown Het
Cd72 T C 4: 43,450,141 (GRCm39) S256G possibly damaging Het
Celf2 G T 2: 6,551,915 (GRCm39) N521K probably benign Het
Clca4a T A 3: 144,672,133 (GRCm39) N270Y possibly damaging Het
Clvs2 A T 10: 33,404,382 (GRCm39) V278E probably benign Het
Cwf19l2 T C 9: 3,454,718 (GRCm39) F677S probably damaging Het
Dnaaf4 A G 9: 72,871,462 (GRCm39) T241A probably damaging Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 72,684,217 (GRCm39) probably benign Het
Epdr1 T C 13: 19,778,707 (GRCm39) N130D possibly damaging Het
Fam184a G A 10: 53,566,115 (GRCm39) R491W probably benign Het
Foxp2 A G 6: 15,377,969 (GRCm39) Q160R unknown Het
Fstl5 T A 3: 76,555,669 (GRCm39) Y515* probably null Het
Garin5b T C 7: 4,760,712 (GRCm39) M667V Het
Helz2 G T 2: 180,882,741 (GRCm39) N17K probably benign Het
Irag1 A G 7: 110,545,038 (GRCm39) probably null Het
Jmjd1c C T 10: 66,932,495 (GRCm39) probably benign Het
Jup C T 11: 100,270,391 (GRCm39) C372Y probably damaging Het
Lrrn1 A C 6: 107,545,465 (GRCm39) Q421P possibly damaging Het
Mapk1 A G 16: 16,836,154 (GRCm39) I101V probably benign Het
Me2 T C 18: 73,918,800 (GRCm39) E427G probably damaging Het
Mrc1 G A 2: 14,274,999 (GRCm39) M433I probably damaging Het
Nelfb G A 2: 25,095,218 (GRCm39) R324W probably damaging Het
Nlrp4b T A 7: 10,449,126 (GRCm39) I443K probably benign Het
Nup210l C T 3: 90,107,173 (GRCm39) P1570L probably benign Het
Or5b118 A G 19: 13,449,216 (GRCm39) E294G probably damaging Het
Or8b50 G A 9: 38,518,142 (GRCm39) C127Y possibly damaging Het
Or8b9 T A 9: 37,766,750 (GRCm39) V212D probably damaging Het
Or9g3 A T 2: 85,590,275 (GRCm39) Y148* probably null Het
Parvb C T 15: 84,188,100 (GRCm39) T281I probably damaging Het
Runx3 A G 4: 134,848,456 (GRCm39) T14A probably benign Het
Scn9a A G 2: 66,314,261 (GRCm39) V1819A probably benign Het
Senp1 T C 15: 97,964,435 (GRCm39) T260A probably benign Het
Serpinb10 A G 1: 107,474,749 (GRCm39) R304G possibly damaging Het
Spem1 C T 11: 69,712,640 (GRCm39) C65Y probably benign Het
Tdrd6 A G 17: 43,939,053 (GRCm39) V665A possibly damaging Het
Tenm2 C T 11: 35,930,713 (GRCm39) A1772T probably damaging Het
Tenm3 C T 8: 48,752,690 (GRCm39) V891I probably damaging Het
Trank1 A G 9: 111,194,259 (GRCm39) D761G probably benign Het
Tut7 T C 13: 59,944,681 (GRCm39) S1053G probably damaging Het
Ubap2l A T 3: 89,915,587 (GRCm39) Y985N unknown Het
Vwc2l A T 1: 70,768,218 (GRCm39) H94L probably damaging Het
Wdr27 G A 17: 15,154,795 (GRCm39) H41Y probably benign Het
Zfp7 AGTGCGGGAAAGGTTTCCACCTG AG 15: 76,774,798 (GRCm39) probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,774,800 (GRCm39) probably benign Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17,145,708 (GRCm39) critical splice donor site probably null
IGL00848:Prune2 APN 19 17,096,482 (GRCm39) missense probably damaging 1.00
IGL00862:Prune2 APN 19 17,096,713 (GRCm39) missense probably benign 0.41
IGL00915:Prune2 APN 19 16,993,617 (GRCm39) missense probably damaging 1.00
IGL01084:Prune2 APN 19 17,095,573 (GRCm39) missense probably benign 0.19
IGL01109:Prune2 APN 19 17,101,243 (GRCm39) missense probably benign 0.03
IGL01372:Prune2 APN 19 17,102,433 (GRCm39) missense probably damaging 1.00
IGL01650:Prune2 APN 19 17,145,656 (GRCm39) missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17,101,267 (GRCm39) missense possibly damaging 0.50
IGL01812:Prune2 APN 19 16,981,141 (GRCm39) missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17,096,002 (GRCm39) missense probably benign 0.00
IGL02195:Prune2 APN 19 17,096,921 (GRCm39) missense probably benign 0.00
IGL02502:Prune2 APN 19 17,101,245 (GRCm39) missense probably benign 0.00
IGL02569:Prune2 APN 19 17,156,223 (GRCm39) missense probably damaging 0.99
IGL02693:Prune2 APN 19 17,101,855 (GRCm39) missense probably benign 0.03
IGL02737:Prune2 APN 19 17,170,775 (GRCm39) nonsense probably null
IGL02794:Prune2 APN 19 17,096,725 (GRCm39) missense probably benign 0.19
IGL02985:Prune2 APN 19 16,993,723 (GRCm39) critical splice donor site probably null
IGL03349:Prune2 APN 19 17,100,710 (GRCm39) missense probably damaging 1.00
3-1:Prune2 UTSW 19 17,102,646 (GRCm39) missense probably benign 0.00
R0060:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17,099,974 (GRCm39) missense probably benign 0.00
R0277:Prune2 UTSW 19 17,098,753 (GRCm39) missense probably damaging 0.99
R0321:Prune2 UTSW 19 17,099,818 (GRCm39) missense probably benign 0.39
R0321:Prune2 UTSW 19 17,098,291 (GRCm39) missense possibly damaging 0.78
R0374:Prune2 UTSW 19 17,098,274 (GRCm39) missense probably benign 0.00
R0380:Prune2 UTSW 19 17,101,371 (GRCm39) missense probably damaging 1.00
R0396:Prune2 UTSW 19 17,100,444 (GRCm39) missense probably benign 0.35
R0408:Prune2 UTSW 19 17,099,674 (GRCm39) missense probably benign 0.00
R0421:Prune2 UTSW 19 17,100,675 (GRCm39) missense probably benign 0.02
R0480:Prune2 UTSW 19 16,984,156 (GRCm39) splice site probably benign
R0531:Prune2 UTSW 19 16,984,117 (GRCm39) missense probably damaging 1.00
R0546:Prune2 UTSW 19 16,998,030 (GRCm39) splice site probably benign
R0554:Prune2 UTSW 19 17,102,582 (GRCm39) nonsense probably null
R0659:Prune2 UTSW 19 17,100,199 (GRCm39) missense probably damaging 1.00
R0699:Prune2 UTSW 19 17,101,319 (GRCm39) missense probably damaging 1.00
R0781:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1110:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1178:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1181:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1337:Prune2 UTSW 19 17,096,971 (GRCm39) missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17,189,681 (GRCm39) missense probably benign 0.40
R1385:Prune2 UTSW 19 17,102,312 (GRCm39) missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17,098,015 (GRCm39) missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17,102,374 (GRCm39) missense probably benign 0.01
R1756:Prune2 UTSW 19 17,101,068 (GRCm39) missense probably benign 0.01
R1765:Prune2 UTSW 19 17,102,962 (GRCm39) missense probably damaging 1.00
R1782:Prune2 UTSW 19 17,099,537 (GRCm39) missense probably benign 0.00
R1817:Prune2 UTSW 19 17,099,445 (GRCm39) missense probably benign 0.00
R1838:Prune2 UTSW 19 17,177,242 (GRCm39) missense probably damaging 1.00
R1851:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1852:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1866:Prune2 UTSW 19 17,100,856 (GRCm39) missense probably damaging 1.00
R1911:Prune2 UTSW 19 17,091,038 (GRCm39) missense probably benign 0.02
R1983:Prune2 UTSW 19 16,998,006 (GRCm39) missense probably damaging 0.97
R2014:Prune2 UTSW 19 17,097,887 (GRCm39) missense probably damaging 1.00
R2066:Prune2 UTSW 19 17,098,042 (GRCm39) missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17,097,109 (GRCm39) missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17,185,602 (GRCm39) missense probably damaging 1.00
R2128:Prune2 UTSW 19 17,099,786 (GRCm39) missense probably benign 0.00
R2165:Prune2 UTSW 19 17,097,546 (GRCm39) missense probably benign 0.19
R2241:Prune2 UTSW 19 17,100,456 (GRCm39) missense probably damaging 0.96
R2278:Prune2 UTSW 19 17,095,919 (GRCm39) missense possibly damaging 0.93
R2504:Prune2 UTSW 19 16,977,400 (GRCm39) missense probably damaging 1.00
R2508:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R3055:Prune2 UTSW 19 17,102,407 (GRCm39) missense probably damaging 0.98
R3086:Prune2 UTSW 19 17,098,777 (GRCm39) missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3105:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3547:Prune2 UTSW 19 17,101,712 (GRCm39) missense probably damaging 0.96
R3702:Prune2 UTSW 19 17,156,235 (GRCm39) missense probably damaging 1.00
R3753:Prune2 UTSW 19 17,102,818 (GRCm39) missense probably benign 0.38
R3933:Prune2 UTSW 19 17,101,318 (GRCm39) missense probably damaging 1.00
R3935:Prune2 UTSW 19 17,177,150 (GRCm39) missense probably damaging 1.00
R4022:Prune2 UTSW 19 16,977,384 (GRCm39) missense probably damaging 1.00
R4042:Prune2 UTSW 19 16,981,190 (GRCm39) critical splice donor site probably null
R4164:Prune2 UTSW 19 16,981,098 (GRCm39) missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17,099,274 (GRCm39) missense probably benign 0.00
R4642:Prune2 UTSW 19 16,998,019 (GRCm39) critical splice donor site probably null
R4661:Prune2 UTSW 19 16,977,387 (GRCm39) missense probably damaging 1.00
R4666:Prune2 UTSW 19 17,097,552 (GRCm39) nonsense probably null
R4823:Prune2 UTSW 19 17,097,868 (GRCm39) missense probably damaging 1.00
R4897:Prune2 UTSW 19 17,099,219 (GRCm39) missense probably benign 0.03
R4922:Prune2 UTSW 19 17,100,116 (GRCm39) missense probably benign 0.00
R4962:Prune2 UTSW 19 17,099,637 (GRCm39) missense probably benign 0.11
R5026:Prune2 UTSW 19 17,176,506 (GRCm39) missense probably damaging 1.00
R5042:Prune2 UTSW 19 17,097,161 (GRCm39) missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17,177,274 (GRCm39) missense probably damaging 1.00
R5133:Prune2 UTSW 19 16,980,995 (GRCm39) missense probably damaging 1.00
R5184:Prune2 UTSW 19 17,193,721 (GRCm39) missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5339:Prune2 UTSW 19 17,098,236 (GRCm39) missense probably damaging 1.00
R5363:Prune2 UTSW 19 17,095,630 (GRCm39) missense probably damaging 1.00
R5382:Prune2 UTSW 19 16,981,023 (GRCm39) missense probably damaging 1.00
R5436:Prune2 UTSW 19 16,998,007 (GRCm39) missense probably damaging 1.00
R5480:Prune2 UTSW 19 17,098,311 (GRCm39) missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17,095,573 (GRCm39) missense probably benign 0.19
R5678:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5814:Prune2 UTSW 19 16,993,725 (GRCm39) splice site probably null
R5894:Prune2 UTSW 19 17,098,755 (GRCm39) missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17,096,080 (GRCm39) missense probably benign 0.35
R6207:Prune2 UTSW 19 17,095,480 (GRCm39) missense probably damaging 1.00
R6218:Prune2 UTSW 19 17,098,926 (GRCm39) missense probably benign 0.00
R6573:Prune2 UTSW 19 17,098,521 (GRCm39) missense probably damaging 1.00
R6573:Prune2 UTSW 19 17,098,522 (GRCm39) missense possibly damaging 0.61
R6734:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R6805:Prune2 UTSW 19 17,097,954 (GRCm39) missense probably benign
R6837:Prune2 UTSW 19 17,156,292 (GRCm39) missense probably damaging 1.00
R6850:Prune2 UTSW 19 17,099,552 (GRCm39) missense probably benign 0.00
R6858:Prune2 UTSW 19 17,095,470 (GRCm39) missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17,100,592 (GRCm39) missense probably damaging 1.00
R6954:Prune2 UTSW 19 16,977,385 (GRCm39) missense probably damaging 1.00
R7098:Prune2 UTSW 19 17,097,966 (GRCm39) missense probably benign 0.39
R7102:Prune2 UTSW 19 17,098,577 (GRCm39) missense probably benign 0.24
R7246:Prune2 UTSW 19 17,098,732 (GRCm39) missense probably damaging 0.99
R7284:Prune2 UTSW 19 17,097,250 (GRCm39) missense probably damaging 1.00
R7295:Prune2 UTSW 19 17,097,261 (GRCm39) missense probably benign 0.01
R7371:Prune2 UTSW 19 17,096,734 (GRCm39) missense probably benign 0.02
R7651:Prune2 UTSW 19 17,097,772 (GRCm39) missense probably damaging 1.00
R7830:Prune2 UTSW 19 17,100,038 (GRCm39) missense probably benign 0.21
R7872:Prune2 UTSW 19 17,096,798 (GRCm39) missense probably benign 0.05
R7881:Prune2 UTSW 19 17,100,393 (GRCm39) missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17,156,223 (GRCm39) missense probably damaging 0.99
R7969:Prune2 UTSW 19 17,179,034 (GRCm39) missense probably damaging 0.98
R8092:Prune2 UTSW 19 17,097,357 (GRCm39) missense probably damaging 1.00
R8110:Prune2 UTSW 19 17,098,083 (GRCm39) missense probably benign 0.22
R8115:Prune2 UTSW 19 17,101,288 (GRCm39) missense probably benign 0.02
R8129:Prune2 UTSW 19 17,096,200 (GRCm39) missense probably benign 0.01
R8169:Prune2 UTSW 19 17,102,455 (GRCm39) missense probably benign 0.10
R8171:Prune2 UTSW 19 17,097,882 (GRCm39) missense probably damaging 1.00
R8176:Prune2 UTSW 19 17,095,656 (GRCm39) missense probably damaging 1.00
R8200:Prune2 UTSW 19 17,102,337 (GRCm39) missense probably benign 0.01
R8217:Prune2 UTSW 19 17,097,480 (GRCm39) missense probably benign 0.01
R8258:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8259:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8289:Prune2 UTSW 19 17,100,373 (GRCm39) missense probably benign 0.43
R8329:Prune2 UTSW 19 17,098,629 (GRCm39) missense probably benign 0.02
R8342:Prune2 UTSW 19 17,103,027 (GRCm39) missense probably benign 0.01
R8558:Prune2 UTSW 19 17,099,602 (GRCm39) missense probably damaging 0.98
R8732:Prune2 UTSW 19 17,097,769 (GRCm39) missense probably damaging 1.00
R8743:Prune2 UTSW 19 17,096,920 (GRCm39) missense probably benign 0.22
R8769:Prune2 UTSW 19 17,100,442 (GRCm39) missense probably damaging 0.96
R8862:Prune2 UTSW 19 17,097,510 (GRCm39) missense probably benign 0.04
R8936:Prune2 UTSW 19 17,099,199 (GRCm39) missense probably benign 0.24
R9040:Prune2 UTSW 19 17,097,991 (GRCm39) missense probably damaging 1.00
R9084:Prune2 UTSW 19 17,097,741 (GRCm39) missense probably damaging 1.00
R9224:Prune2 UTSW 19 17,097,393 (GRCm39) missense probably damaging 1.00
R9273:Prune2 UTSW 19 17,095,690 (GRCm39) missense possibly damaging 0.74
R9275:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9278:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9290:Prune2 UTSW 19 17,145,691 (GRCm39) missense probably benign 0.41
R9305:Prune2 UTSW 19 17,097,625 (GRCm39) missense probably benign 0.14
R9317:Prune2 UTSW 19 17,099,034 (GRCm39) missense probably benign 0.00
R9354:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R9394:Prune2 UTSW 19 16,981,053 (GRCm39) missense probably damaging 1.00
R9405:Prune2 UTSW 19 17,193,708 (GRCm39) missense probably damaging 0.99
R9476:Prune2 UTSW 19 17,096,706 (GRCm39) missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17,099,794 (GRCm39) missense probably benign 0.00
X0019:Prune2 UTSW 19 17,098,881 (GRCm39) missense probably benign 0.16
X0028:Prune2 UTSW 19 17,100,249 (GRCm39) missense probably damaging 1.00
X0064:Prune2 UTSW 19 17,099,739 (GRCm39) missense probably damaging 1.00
X0066:Prune2 UTSW 19 17,096,154 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCCCAGAGATTCCAAATGATCC -3'
(R):5'- CACTGAACGGGCTTGACTTG -3'

Sequencing Primer
(F):5'- AATGATCCCTTCAACAGTGGTC -3'
(R):5'- AACGGGCTTGACTTGTTCTC -3'
Posted On 2022-04-18