Incidental Mutation 'R9373:Dusp9'
ID 709470
Institutional Source Beutler Lab
Gene Symbol Dusp9
Ensembl Gene ENSMUSG00000031383
Gene Name dual specificity phosphatase 9
Synonyms Mpk4, Pyst3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.154) question?
Stock # R9373 (G1)
Quality Score 107.592
Status Validated
Chromosome X
Chromosomal Location 73639419-73643514 bp(+) (GRCm38)
Type of Mutation small deletion (16 aa in frame mutation)
DNA Base Change (assembly) TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG to TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG at 73640611 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019701]
AlphaFold Q7TNL7
Predicted Effect probably benign
Transcript: ENSMUST00000019701
SMART Domains Protein: ENSMUSP00000019701
Gene: ENSMUSG00000031383

DomainStartEndE-ValueType
RHOD 8 204 2.51e-9 SMART
low complexity region 236 249 N/A INTRINSIC
DSPc 271 411 6.09e-67 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (MAPK/ERK, SAPK/JNK, p38), which is associated with cellular proliferation and differentiation. Different members of the family of dual specificity phosphatases show distinct substrate specificities for various MAP kinases, different tissue distribution and subcellular localization, and different modes of inducibility of their expression by extracellular stimuli. This gene product shows selectivity for members of the ERK family of MAP kinases and is localized to the cytoplasm and nucleus. Aberrant expression of this gene is associated with type 2 diabetes and cancer progression in several cell types. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Hemizygous null male and heterozygous null female mice display embryonic lethality during organogenesis with abnormal placental labyrinth morphology when the allele is maternally inherited. Tetraploid rescue produces viable heterozygous and hemizygous mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002D01Rik CCTTCTCCTTCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC CCTTCTCCTTCTTCTCCTTCTTCTCCATCTTCTCCTTCTTC 7: 29,247,623 probably benign Het
2310003L06Rik A C 5: 87,972,809 D475A probably benign Het
3110043O21Rik A G 4: 35,196,985 F360S Het
Aatk T C 11: 120,015,517 M243V possibly damaging Het
Acox1 A T 11: 116,174,347 N627K possibly damaging Het
Adal A G 2: 121,150,222 Y142C probably benign Het
Agfg2 A G 5: 137,664,214 probably null Het
Ajap1 C T 4: 153,432,213 A224T probably benign Het
Alg1 T C 16: 5,239,126 F234L probably benign Het
Arhgap27 G T 11: 103,360,461 A147E possibly damaging Het
Cachd1 T C 4: 100,974,870 V743A possibly damaging Het
Cc2d2b G A 19: 40,795,723 V655I unknown Het
Cd72 T C 4: 43,450,141 S256G possibly damaging Het
Celf2 G T 2: 6,547,104 N521K probably benign Het
Clca4a T A 3: 144,966,372 N270Y possibly damaging Het
Clvs2 A T 10: 33,528,386 V278E probably benign Het
Cwf19l2 T C 9: 3,454,718 F677S probably damaging Het
Dyx1c1 A G 9: 72,964,180 T241A probably damaging Het
Epdr1 T C 13: 19,594,537 N130D possibly damaging Het
Fam184a G A 10: 53,690,019 R491W probably benign Het
Fam71e2 T C 7: 4,757,713 M667V Het
Foxp2 A G 6: 15,377,970 Q160R unknown Het
Fstl5 T A 3: 76,648,362 Y515* probably null Het
Helz2 G T 2: 181,240,948 N17K probably benign Het
Jmjd1c C T 10: 67,096,716 probably benign Het
Jup C T 11: 100,379,565 C372Y probably damaging Het
Lrrn1 A C 6: 107,568,504 Q421P possibly damaging Het
Mapk1 A G 16: 17,018,290 I101V probably benign Het
Me2 T C 18: 73,785,729 E427G probably damaging Het
Mrc1 G A 2: 14,270,188 M433I probably damaging Het
Mrvi1 A G 7: 110,945,831 probably null Het
Nelfb G A 2: 25,205,206 R324W probably damaging Het
Nlrp4b T A 7: 10,715,199 I443K probably benign Het
Nup210l C T 3: 90,199,866 P1570L probably benign Het
Olfr1012 A T 2: 85,759,931 Y148* probably null Het
Olfr1474 A G 19: 13,471,852 E294G probably damaging Het
Olfr877 T A 9: 37,855,454 V212D probably damaging Het
Olfr914 G A 9: 38,606,846 C127Y possibly damaging Het
Parvb C T 15: 84,303,899 T281I probably damaging Het
Prune2 A G 19: 17,122,138 T1669A probably benign Het
Runx3 A G 4: 135,121,145 T14A probably benign Het
Scn9a A G 2: 66,483,917 V1819A probably benign Het
Senp1 T C 15: 98,066,554 T260A probably benign Het
Serpinb10 A G 1: 107,547,019 R304G possibly damaging Het
Spem1 C T 11: 69,821,814 C65Y probably benign Het
Tdrd6 A G 17: 43,628,162 V665A possibly damaging Het
Tenm2 C T 11: 36,039,886 A1772T probably damaging Het
Tenm3 C T 8: 48,299,655 V891I probably damaging Het
Trank1 A G 9: 111,365,191 D761G probably benign Het
Ubap2l A T 3: 90,008,280 Y985N unknown Het
Vwc2l A T 1: 70,729,059 H94L probably damaging Het
Wdr27 G A 17: 14,934,533 H41Y probably benign Het
Zcchc6 T C 13: 59,796,867 S1053G probably damaging Het
Zfp7 AGTGCGGGAAAGGTTTCCACCTG AG 15: 76,890,598 probably benign Het
Zfp7 TGCGGGAAAGGTTTCCACCTGAGCG TGCG 15: 76,890,600 probably benign Het
Other mutations in Dusp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02968:Dusp9 APN X 73641433 missense probably benign 0.00
R4654:Dusp9 UTSW X 73640772 missense probably benign 0.31
R7075:Dusp9 UTSW X 73640611 small deletion probably benign
R7389:Dusp9 UTSW X 73640611 small deletion probably benign
R7412:Dusp9 UTSW X 73640611 small deletion probably benign
R7930:Dusp9 UTSW X 73640522 small deletion probably benign
R7958:Dusp9 UTSW X 73640611 small deletion probably benign
R8228:Dusp9 UTSW X 73640611 small deletion probably benign
R8258:Dusp9 UTSW X 73640611 small deletion probably benign
R8334:Dusp9 UTSW X 73640611 small deletion probably benign
R8970:Dusp9 UTSW X 73640611 small deletion probably benign
R9010:Dusp9 UTSW X 73640611 small deletion probably benign
R9140:Dusp9 UTSW X 73640611 small deletion probably benign
R9173:Dusp9 UTSW X 73640611 small deletion probably benign
R9241:Dusp9 UTSW X 73640611 small deletion probably benign
R9359:Dusp9 UTSW X 73640611 small deletion probably benign
R9474:Dusp9 UTSW X 73640611 small deletion probably benign
R9548:Dusp9 UTSW X 73640611 small deletion probably benign
R9780:Dusp9 UTSW X 73640611 small deletion probably benign
RF030:Dusp9 UTSW X 73640611 small deletion probably benign
RF039:Dusp9 UTSW X 73640611 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GAGAGTCTGAGTCGGTCATG -3'
(R):5'- GGATCTTTTCTCCTGACCTGAG -3'

Sequencing Primer
(F):5'- AGCTGTATGAGTCGGCGC -3'
(R):5'- TCCAGAGTGCTCTCTCAGG -3'
Posted On 2022-04-18