Incidental Mutation 'R9374:Olfr1162'
ID 709479
Institutional Source Beutler Lab
Gene Symbol Olfr1162
Ensembl Gene ENSMUSG00000075139
Gene Name olfactory receptor 1162
Synonyms MOR174-14, GA_x6K02T2Q125-49542541-49541597
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R9374 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 88045920-88051129 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 88050165 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 153 (W153*)
Ref Sequence ENSEMBL: ENSMUSP00000139068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099837] [ENSMUST00000183862]
AlphaFold Q7TR28
Predicted Effect probably null
Transcript: ENSMUST00000099837
AA Change: W153*
SMART Domains Protein: ENSMUSP00000097425
Gene: ENSMUSG00000075139
AA Change: W153*

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.9e-46 PFAM
Pfam:7tm_1 43 292 1.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000183862
AA Change: W153*
SMART Domains Protein: ENSMUSP00000139068
Gene: ENSMUSG00000075139
AA Change: W153*

DomainStartEndE-ValueType
Pfam:7tm_1 43 292 4.2e-27 PFAM
Pfam:7tm_4 141 285 3.1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aes T C 10: 81,564,154 V62A probably damaging Het
Arhgap21 A T 2: 20,881,586 V270E probably damaging Het
Blvrb A G 7: 27,459,361 D62G probably benign Het
Ccdc68 T A 18: 69,956,042 S219T probably damaging Het
Celf2 G A 2: 6,586,075 T303I possibly damaging Het
Cep290 T C 10: 100,536,867 S1176P probably damaging Het
Cpeb2 C A 5: 43,234,241 S260* probably null Het
Dscam A T 16: 97,056,657 I51N probably benign Het
Erbb4 G A 1: 68,740,483 Q45* probably null Het
Fam124a T G 14: 62,606,539 S499A possibly damaging Het
Hipk3 T C 2: 104,471,505 N114S probably benign Het
Hnrnph3 T C 10: 63,018,178 M54V probably benign Het
Map7d1 T C 4: 126,233,636 E720G unknown Het
Mark2 G T 19: 7,285,898 T201N possibly damaging Het
Mef2c A G 13: 83,662,342 N371S probably benign Het
Mgst3 T C 1: 167,378,302 Y36C probably damaging Het
Mtor C T 4: 148,514,940 R1482C probably damaging Het
Ndst1 G T 18: 60,712,859 T126K probably damaging Het
Nkain3 C A 4: 20,778,431 probably benign Het
Obscn T C 11: 59,031,961 I5850V possibly damaging Het
Olfr424 A T 1: 174,137,319 T192S probably benign Het
Olfr738 C T 14: 50,414,168 S208F probably benign Het
Pbx1 T C 1: 168,431,341 D55G possibly damaging Het
Pi4ka T C 16: 17,307,710 E1187G Het
Pkn1 A T 8: 83,677,738 N543K probably benign Het
Plin1 T C 7: 79,722,796 N343D probably benign Het
Prpf4 T C 4: 62,417,894 V286A probably benign Het
Pyroxd2 A G 19: 42,731,317 probably null Het
Rbpms A G 8: 33,804,145 F190S possibly damaging Het
Rpl10a T A 17: 28,329,032 F49Y possibly damaging Het
Slc32a1 A G 2: 158,614,075 T217A probably damaging Het
Slco6c1 T C 1: 97,128,102 S25G probably benign Het
Slitrk5 C T 14: 111,679,064 T40I probably benign Het
Smchd1 T C 17: 71,411,848 N842S possibly damaging Het
Sorbs1 G A 19: 40,373,479 R154* probably null Het
Stc2 A G 11: 31,360,332 S235P probably benign Het
Tcaf2 C T 6: 42,642,794 A100T probably benign Het
Tcerg1l T C 7: 138,394,269 D170G possibly damaging Het
Tcf15 T C 2: 152,144,119 L165P probably damaging Het
Tmem200c G T 17: 68,841,687 G422W probably damaging Het
Tnfsf13b A G 8: 10,035,391 I294V possibly damaging Het
Tns3 T A 11: 8,492,606 T586S probably damaging Het
Unc80 A T 1: 66,590,301 E1319V possibly damaging Het
Vegfc A G 8: 54,169,145 I221V possibly damaging Het
Vmn1r86 A T 7: 13,102,854 Y32N possibly damaging Het
Vmn2r111 T A 17: 22,568,878 L497F probably benign Het
Wdr49 T C 3: 75,323,624 D577G probably benign Het
Xpo4 A G 14: 57,591,055 F783L possibly damaging Het
Other mutations in Olfr1162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr1162 APN 2 88049784 missense possibly damaging 0.63
IGL01965:Olfr1162 APN 2 88050436 missense probably benign 0.14
IGL02183:Olfr1162 APN 2 88049989 missense possibly damaging 0.96
R0281:Olfr1162 UTSW 2 88050412 missense possibly damaging 0.96
R0501:Olfr1162 UTSW 2 88050471 missense probably damaging 1.00
R4254:Olfr1162 UTSW 2 88049779 missense possibly damaging 0.62
R4589:Olfr1162 UTSW 2 88050479 missense probably benign 0.12
R4824:Olfr1162 UTSW 2 88050088 missense probably damaging 1.00
R5148:Olfr1162 UTSW 2 88050393 missense probably benign 0.08
R5580:Olfr1162 UTSW 2 88050324 missense possibly damaging 0.79
R6174:Olfr1162 UTSW 2 88050302 nonsense probably null
R6888:Olfr1162 UTSW 2 88050264 missense probably damaging 1.00
R7935:Olfr1162 UTSW 2 88049946 missense probably damaging 1.00
R7951:Olfr1162 UTSW 2 88050257 nonsense probably null
R9123:Olfr1162 UTSW 2 88049950 missense probably damaging 0.99
R9125:Olfr1162 UTSW 2 88049950 missense probably damaging 0.99
R9133:Olfr1162 UTSW 2 88050438 missense probably damaging 1.00
R9280:Olfr1162 UTSW 2 88050114 missense probably damaging 1.00
R9552:Olfr1162 UTSW 2 88050165 nonsense probably null
Z1177:Olfr1162 UTSW 2 88050304 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGAATGATCAAGAGTGTACTCAC -3'
(R):5'- GCTTGAAAACTTGGTCCTGGC -3'

Sequencing Primer
(F):5'- GTACTCACTTCATTGAAGGTTGC -3'
(R):5'- ACTTGGTCCTGGCTGATAAAAC -3'
Posted On 2022-04-18