Incidental Mutation 'R9374:Hipk3'
ID 709480
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Name homeodomain interacting protein kinase 3
Synonyms DYRK6, FIST3
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9374 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 104256826-104324791 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 104301850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 114 (N114S)
Ref Sequence ENSEMBL: ENSMUSP00000028600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
AlphaFold Q9ERH7
Predicted Effect probably benign
Transcript: ENSMUST00000028600
AA Change: N114S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: N114S

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111124
AA Change: N114S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: N114S

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111125
AA Change: N114S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: N114S

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,886,397 (GRCm39) V270E probably damaging Het
Blvrb A G 7: 27,158,786 (GRCm39) D62G probably benign Het
Ccdc68 T A 18: 70,089,113 (GRCm39) S219T probably damaging Het
Celf2 G A 2: 6,590,886 (GRCm39) T303I possibly damaging Het
Cep290 T C 10: 100,372,729 (GRCm39) S1176P probably damaging Het
Cpeb2 C A 5: 43,391,584 (GRCm39) S260* probably null Het
Dscam A T 16: 96,857,857 (GRCm39) I51N probably benign Het
Erbb4 G A 1: 68,779,642 (GRCm39) Q45* probably null Het
Fam124a T G 14: 62,843,988 (GRCm39) S499A possibly damaging Het
Hnrnph3 T C 10: 62,853,957 (GRCm39) M54V probably benign Het
Map7d1 T C 4: 126,127,429 (GRCm39) E720G unknown Het
Mark2 G T 19: 7,263,263 (GRCm39) T201N possibly damaging Het
Mef2c A G 13: 83,810,461 (GRCm39) N371S probably benign Het
Mgst3 T C 1: 167,205,871 (GRCm39) Y36C probably damaging Het
Mtor C T 4: 148,599,397 (GRCm39) R1482C probably damaging Het
Ndst1 G T 18: 60,845,931 (GRCm39) T126K probably damaging Het
Nkain3 C A 4: 20,778,431 (GRCm39) probably benign Het
Obscn T C 11: 58,922,787 (GRCm39) I5850V possibly damaging Het
Or11g1 C T 14: 50,651,625 (GRCm39) S208F probably benign Het
Or5d14 C T 2: 87,880,509 (GRCm39) W153* probably null Het
Or6k4 A T 1: 173,964,885 (GRCm39) T192S probably benign Het
Pbx1 T C 1: 168,258,910 (GRCm39) D55G possibly damaging Het
Pi4ka T C 16: 17,125,574 (GRCm39) E1187G Het
Pkn1 A T 8: 84,404,367 (GRCm39) N543K probably benign Het
Plin1 T C 7: 79,372,544 (GRCm39) N343D probably benign Het
Prpf4 T C 4: 62,336,131 (GRCm39) V286A probably benign Het
Pyroxd2 A G 19: 42,719,756 (GRCm39) probably null Het
Rbpms A G 8: 34,294,173 (GRCm39) F190S possibly damaging Het
Rpl10a T A 17: 28,548,006 (GRCm39) F49Y possibly damaging Het
Slc32a1 A G 2: 158,455,995 (GRCm39) T217A probably damaging Het
Slco6c1 T C 1: 97,055,827 (GRCm39) S25G probably benign Het
Slitrk5 C T 14: 111,916,496 (GRCm39) T40I probably benign Het
Smchd1 T C 17: 71,718,843 (GRCm39) N842S possibly damaging Het
Sorbs1 G A 19: 40,361,923 (GRCm39) R154* probably null Het
Stc2 A G 11: 31,310,332 (GRCm39) S235P probably benign Het
Tcaf2 C T 6: 42,619,728 (GRCm39) A100T probably benign Het
Tcerg1l T C 7: 137,995,998 (GRCm39) D170G possibly damaging Het
Tcf15 T C 2: 151,986,039 (GRCm39) L165P probably damaging Het
Tle5 T C 10: 81,399,988 (GRCm39) V62A probably damaging Het
Tmem200c G T 17: 69,148,682 (GRCm39) G422W probably damaging Het
Tnfsf13b A G 8: 10,085,391 (GRCm39) I294V possibly damaging Het
Tns3 T A 11: 8,442,606 (GRCm39) T586S probably damaging Het
Unc80 A T 1: 66,629,460 (GRCm39) E1319V possibly damaging Het
Vegfc A G 8: 54,622,180 (GRCm39) I221V possibly damaging Het
Vmn1r86 A T 7: 12,836,781 (GRCm39) Y32N possibly damaging Het
Vmn2r111 T A 17: 22,787,859 (GRCm39) L497F probably benign Het
Wdr49 T C 3: 75,230,931 (GRCm39) D577G probably benign Het
Xpo4 A G 14: 57,828,512 (GRCm39) F783L possibly damaging Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104,260,576 (GRCm39) missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104,263,517 (GRCm39) missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104,267,434 (GRCm39) missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104,302,198 (GRCm39) splice site probably benign
IGL01932:Hipk3 APN 2 104,301,326 (GRCm39) missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104,261,724 (GRCm39) missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104,301,676 (GRCm39) missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104,301,757 (GRCm39) missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104,301,604 (GRCm39) missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104,264,086 (GRCm39) missense probably damaging 1.00
R0136:Hipk3 UTSW 2 104,269,638 (GRCm39) missense probably benign 0.02
R0277:Hipk3 UTSW 2 104,271,593 (GRCm39) missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104,263,552 (GRCm39) missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104,261,594 (GRCm39) nonsense probably null
R0597:Hipk3 UTSW 2 104,263,982 (GRCm39) missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104,302,043 (GRCm39) missense probably benign 0.00
R1171:Hipk3 UTSW 2 104,302,021 (GRCm39) missense probably benign 0.02
R1244:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104,271,607 (GRCm39) missense probably benign 0.01
R1616:Hipk3 UTSW 2 104,264,090 (GRCm39) nonsense probably null
R1893:Hipk3 UTSW 2 104,263,601 (GRCm39) missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104,260,533 (GRCm39) missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104,264,186 (GRCm39) missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104,301,518 (GRCm39) missense probably benign 0.00
R1985:Hipk3 UTSW 2 104,264,780 (GRCm39) missense probably benign 0.16
R2105:Hipk3 UTSW 2 104,269,737 (GRCm39) missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104,301,830 (GRCm39) missense probably benign 0.01
R3028:Hipk3 UTSW 2 104,264,135 (GRCm39) missense probably benign
R3747:Hipk3 UTSW 2 104,271,628 (GRCm39) nonsense probably null
R3923:Hipk3 UTSW 2 104,301,107 (GRCm39) missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104,271,622 (GRCm39) missense probably benign 0.01
R4604:Hipk3 UTSW 2 104,269,674 (GRCm39) missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104,264,104 (GRCm39) missense probably benign 0.00
R5193:Hipk3 UTSW 2 104,260,345 (GRCm39) missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104,265,298 (GRCm39) missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104,270,569 (GRCm39) missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104,302,153 (GRCm39) missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104,301,529 (GRCm39) missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104,268,328 (GRCm39) missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104,264,086 (GRCm39) missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104,301,770 (GRCm39) missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104,269,753 (GRCm39) missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104,276,916 (GRCm39) missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104,269,696 (GRCm39) missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104,265,059 (GRCm39) missense probably benign 0.00
R8780:Hipk3 UTSW 2 104,264,179 (GRCm39) missense probably damaging 0.99
R8843:Hipk3 UTSW 2 104,268,242 (GRCm39) missense probably benign 0.21
R9186:Hipk3 UTSW 2 104,301,439 (GRCm39) missense probably damaging 1.00
R9187:Hipk3 UTSW 2 104,276,936 (GRCm39) missense probably damaging 1.00
R9398:Hipk3 UTSW 2 104,263,562 (GRCm39) missense probably benign 0.01
R9552:Hipk3 UTSW 2 104,301,850 (GRCm39) missense probably benign
R9584:Hipk3 UTSW 2 104,301,910 (GRCm39) missense probably benign 0.01
R9641:Hipk3 UTSW 2 104,267,376 (GRCm39) missense probably benign
X0021:Hipk3 UTSW 2 104,271,711 (GRCm39) critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104,264,974 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCACTAACTGATAGTCGC -3'
(R):5'- CATCCTTCCACGAAAGGTAGTG -3'

Sequencing Primer
(F):5'- GCACTAACTGATAGTCGCCTTCC -3'
(R):5'- TCCACGAAAGGTAGTGCTTTCCAG -3'
Posted On 2022-04-18