Incidental Mutation 'R9374:Vmn1r86'
ID 709490
Institutional Source Beutler Lab
Gene Symbol Vmn1r86
Ensembl Gene ENSMUSG00000070816
Gene Name vomeronasal 1 receptor 86
Synonyms Gm10301
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9374 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 13097531-13119917 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 13102854 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 32 (Y32N)
Ref Sequence ENSEMBL: ENSMUSP00000092423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094828] [ENSMUST00000226604] [ENSMUST00000227220] [ENSMUST00000227700]
AlphaFold L7N213
Predicted Effect possibly damaging
Transcript: ENSMUST00000094828
AA Change: Y32N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092423
Gene: ENSMUSG00000070816
AA Change: Y32N

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 1.1e-14 PFAM
Pfam:V1R 35 301 4e-31 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226604
AA Change: Y32N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227220
AA Change: Y32N

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000227700
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aes T C 10: 81,564,154 V62A probably damaging Het
Arhgap21 A T 2: 20,881,586 V270E probably damaging Het
Blvrb A G 7: 27,459,361 D62G probably benign Het
Ccdc68 T A 18: 69,956,042 S219T probably damaging Het
Celf2 G A 2: 6,586,075 T303I possibly damaging Het
Cep290 T C 10: 100,536,867 S1176P probably damaging Het
Cpeb2 C A 5: 43,234,241 S260* probably null Het
Dscam A T 16: 97,056,657 I51N probably benign Het
Erbb4 G A 1: 68,740,483 Q45* probably null Het
Fam124a T G 14: 62,606,539 S499A possibly damaging Het
Hipk3 T C 2: 104,471,505 N114S probably benign Het
Hnrnph3 T C 10: 63,018,178 M54V probably benign Het
Map7d1 T C 4: 126,233,636 E720G unknown Het
Mark2 G T 19: 7,285,898 T201N possibly damaging Het
Mef2c A G 13: 83,662,342 N371S probably benign Het
Mgst3 T C 1: 167,378,302 Y36C probably damaging Het
Mtor C T 4: 148,514,940 R1482C probably damaging Het
Ndst1 G T 18: 60,712,859 T126K probably damaging Het
Nkain3 C A 4: 20,778,431 probably benign Het
Obscn T C 11: 59,031,961 I5850V possibly damaging Het
Olfr1162 C T 2: 88,050,165 W153* probably null Het
Olfr424 A T 1: 174,137,319 T192S probably benign Het
Olfr738 C T 14: 50,414,168 S208F probably benign Het
Pbx1 T C 1: 168,431,341 D55G possibly damaging Het
Pi4ka T C 16: 17,307,710 E1187G Het
Pkn1 A T 8: 83,677,738 N543K probably benign Het
Plin1 T C 7: 79,722,796 N343D probably benign Het
Prpf4 T C 4: 62,417,894 V286A probably benign Het
Pyroxd2 A G 19: 42,731,317 probably null Het
Rbpms A G 8: 33,804,145 F190S possibly damaging Het
Rpl10a T A 17: 28,329,032 F49Y possibly damaging Het
Slc32a1 A G 2: 158,614,075 T217A probably damaging Het
Slco6c1 T C 1: 97,128,102 S25G probably benign Het
Slitrk5 C T 14: 111,679,064 T40I probably benign Het
Smchd1 T C 17: 71,411,848 N842S possibly damaging Het
Sorbs1 G A 19: 40,373,479 R154* probably null Het
Stc2 A G 11: 31,360,332 S235P probably benign Het
Tcaf2 C T 6: 42,642,794 A100T probably benign Het
Tcerg1l T C 7: 138,394,269 D170G possibly damaging Het
Tcf15 T C 2: 152,144,119 L165P probably damaging Het
Tmem200c G T 17: 68,841,687 G422W probably damaging Het
Tnfsf13b A G 8: 10,035,391 I294V possibly damaging Het
Tns3 T A 11: 8,492,606 T586S probably damaging Het
Unc80 A T 1: 66,590,301 E1319V possibly damaging Het
Vegfc A G 8: 54,169,145 I221V possibly damaging Het
Vmn2r111 T A 17: 22,568,878 L497F probably benign Het
Wdr49 T C 3: 75,323,624 D577G probably benign Het
Xpo4 A G 14: 57,591,055 F783L possibly damaging Het
Other mutations in Vmn1r86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Vmn1r86 APN 7 13102541 missense possibly damaging 0.91
IGL01124:Vmn1r86 APN 7 13102929 missense probably benign 0.04
IGL01291:Vmn1r86 APN 7 13102506 missense probably benign 0.14
IGL02347:Vmn1r86 APN 7 13102647 missense probably damaging 0.99
IGL02457:Vmn1r86 APN 7 13102780 missense probably benign
IGL02983:Vmn1r86 APN 7 13102814 missense probably damaging 1.00
ANU05:Vmn1r86 UTSW 7 13102506 missense probably benign 0.14
R0304:Vmn1r86 UTSW 7 13102780 missense probably benign
R0525:Vmn1r86 UTSW 7 13102161 missense probably benign 0.13
R1958:Vmn1r86 UTSW 7 13102694 missense possibly damaging 0.94
R2227:Vmn1r86 UTSW 7 13102920 missense probably benign 0.00
R3149:Vmn1r86 UTSW 7 13102431 nonsense probably null
R3896:Vmn1r86 UTSW 7 13102166 missense probably benign 0.18
R4735:Vmn1r86 UTSW 7 13102294 missense probably damaging 1.00
R5219:Vmn1r86 UTSW 7 13102455 missense probably damaging 1.00
R6003:Vmn1r86 UTSW 7 13102198 nonsense probably null
R6457:Vmn1r86 UTSW 7 13102352 missense possibly damaging 0.70
R7442:Vmn1r86 UTSW 7 13102056 missense possibly damaging 0.70
R7622:Vmn1r86 UTSW 7 13102758 missense probably benign 0.07
R8436:Vmn1r86 UTSW 7 13102844 missense probably benign 0.25
R9141:Vmn1r86 UTSW 7 13102862 nonsense probably null
R9398:Vmn1r86 UTSW 7 13102334 missense probably damaging 0.98
R9551:Vmn1r86 UTSW 7 13102854 missense possibly damaging 0.86
R9552:Vmn1r86 UTSW 7 13102854 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGCTTAGAACAGAGGTGGTGC -3'
(R):5'- CCTGAGCTGTCACTAAGTATATTTTCC -3'

Sequencing Primer
(F):5'- CGGCTGACTCTGAATGAAAAC -3'
(R):5'- GCATCATGCTTCCAAGTG -3'
Posted On 2022-04-18