Mutagenetix > Incidental Mutation

Incidental Mutation 'R9374:Tns3'

709501

Institutional Source

Beutler Lab

Gene Symbol

Tns3

Ensembl Gene

ENSMUSG00000020422

Gene Name

tensin 3

Synonyms

TEM6, F830010I22Rik, Tens1

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R9374 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8431652-8664535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8492606 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 586 (T586S)

Ref Sequence

ENSEMBL: ENSMUSP00000020695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020695]

AlphaFold

Q5SSZ5

Predicted Effect

probably damaging
Transcript: ENSMUST00000020695
AA Change: T586S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020695
Gene: ENSMUSG00000020422
AA Change: T586S

Domain	Start	End	E-Value	Type
SCOP:d1d5ra2	1	171	5e-28	SMART
PTEN_C2	173	300	1.15e-48	SMART
low complexity region	854	864	N/A	INTRINSIC
low complexity region	1102	1126	N/A	INTRINSIC
SH2	1165	1268	1.32e-18	SMART
PTB	1301	1438	3.14e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit one third postnatal lethality, reduced body weight, growth retardation, smaller digestive tracts with defects in villi and enterocyte differentiation, abnormal lung morphology, and thinner bones with decreased chondrocyte proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aes	T	C	10: 81,564,154	V62A	probably damaging	Het
Arhgap21	A	T	2: 20,881,586	V270E	probably damaging	Het
Blvrb	A	G	7: 27,459,361	D62G	probably benign	Het
Ccdc68	T	A	18: 69,956,042	S219T	probably damaging	Het
Celf2	G	A	2: 6,586,075	T303I	possibly damaging	Het
Cep290	T	C	10: 100,536,867	S1176P	probably damaging	Het
Cpeb2	C	A	5: 43,234,241	S260*	probably null	Het
Dscam	A	T	16: 97,056,657	I51N	probably benign	Het
Erbb4	G	A	1: 68,740,483	Q45*	probably null	Het
Fam124a	T	G	14: 62,606,539	S499A	possibly damaging	Het
Hipk3	T	C	2: 104,471,505	N114S	probably benign	Het
Hnrnph3	T	C	10: 63,018,178	M54V	probably benign	Het
Map7d1	T	C	4: 126,233,636	E720G	unknown	Het
Mark2	G	T	19: 7,285,898	T201N	possibly damaging	Het
Mef2c	A	G	13: 83,662,342	N371S	probably benign	Het
Mgst3	T	C	1: 167,378,302	Y36C	probably damaging	Het
Mtor	C	T	4: 148,514,940	R1482C	probably damaging	Het
Ndst1	G	T	18: 60,712,859	T126K	probably damaging	Het
Nkain3	C	A	4: 20,778,431		probably benign	Het
Obscn	T	C	11: 59,031,961	I5850V	possibly damaging	Het
Olfr1162	C	T	2: 88,050,165	W153*	probably null	Het
Olfr424	A	T	1: 174,137,319	T192S	probably benign	Het
Olfr738	C	T	14: 50,414,168	S208F	probably benign	Het
Pbx1	T	C	1: 168,431,341	D55G	possibly damaging	Het
Pi4ka	T	C	16: 17,307,710	E1187G		Het
Pkn1	A	T	8: 83,677,738	N543K	probably benign	Het
Plin1	T	C	7: 79,722,796	N343D	probably benign	Het
Prpf4	T	C	4: 62,417,894	V286A	probably benign	Het
Pyroxd2	A	G	19: 42,731,317		probably null	Het
Rbpms	A	G	8: 33,804,145	F190S	possibly damaging	Het
Rpl10a	T	A	17: 28,329,032	F49Y	possibly damaging	Het
Slc32a1	A	G	2: 158,614,075	T217A	probably damaging	Het
Slco6c1	T	C	1: 97,128,102	S25G	probably benign	Het
Slitrk5	C	T	14: 111,679,064	T40I	probably benign	Het
Smchd1	T	C	17: 71,411,848	N842S	possibly damaging	Het
Sorbs1	G	A	19: 40,373,479	R154*	probably null	Het
Stc2	A	G	11: 31,360,332	S235P	probably benign	Het
Tcaf2	C	T	6: 42,642,794	A100T	probably benign	Het
Tcerg1l	T	C	7: 138,394,269	D170G	possibly damaging	Het
Tcf15	T	C	2: 152,144,119	L165P	probably damaging	Het
Tmem200c	G	T	17: 68,841,687	G422W	probably damaging	Het
Tnfsf13b	A	G	8: 10,035,391	I294V	possibly damaging	Het
Unc80	A	T	1: 66,590,301	E1319V	possibly damaging	Het
Vegfc	A	G	8: 54,169,145	I221V	possibly damaging	Het
Vmn1r86	A	T	7: 13,102,854	Y32N	possibly damaging	Het
Vmn2r111	T	A	17: 22,568,878	L497F	probably benign	Het
Wdr49	T	C	3: 75,323,624	D577G	probably benign	Het
Xpo4	A	G	14: 57,591,055	F783L	possibly damaging	Het

Other mutations in Tns3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tns3	APN	11	8451066	missense	probably benign	0.42
IGL00822:Tns3	APN	11	8443976	missense	probably damaging	0.99
IGL01075:Tns3	APN	11	8478399	missense	probably benign	0.45
IGL01286:Tns3	APN	11	8492617	missense	probably benign	0.01
IGL01680:Tns3	APN	11	8548937	missense	probably damaging	1.00
IGL01687:Tns3	APN	11	8492798	missense	probably damaging	1.00
IGL01734:Tns3	APN	11	8519192	splice site	probably benign
IGL01844:Tns3	APN	11	8437177	missense	possibly damaging	0.58
IGL01984:Tns3	APN	11	8548992	nonsense	probably null
IGL02137:Tns3	APN	11	8492578	missense	possibly damaging	0.93
IGL02273:Tns3	APN	11	8434531	missense	probably damaging	1.00
IGL02623:Tns3	APN	11	8437141	missense	probably damaging	1.00
IGL02697:Tns3	APN	11	8492346	missense	probably benign	0.00
IGL02829:Tns3	APN	11	8519564	missense	probably damaging	1.00
ANU74:Tns3	UTSW	11	8492149	missense	probably benign	0.38
R0020:Tns3	UTSW	11	8545227	critical splice donor site	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0064:Tns3	UTSW	11	8435856	nonsense	probably null
R0370:Tns3	UTSW	11	8445730	missense	possibly damaging	0.80
R0388:Tns3	UTSW	11	8445703	missense	probably benign	0.07
R0410:Tns3	UTSW	11	8435852	missense	probably benign	0.02
R0496:Tns3	UTSW	11	8547262	splice site	probably benign
R0562:Tns3	UTSW	11	8493262	missense	possibly damaging	0.93
R0626:Tns3	UTSW	11	8493121	missense	probably benign	0.04
R0736:Tns3	UTSW	11	8519474	missense	possibly damaging	0.94
R0893:Tns3	UTSW	11	8493302	missense	probably damaging	1.00
R1367:Tns3	UTSW	11	8448704	missense	probably benign	0.01
R1386:Tns3	UTSW	11	8518261	missense	probably benign	0.02
R1975:Tns3	UTSW	11	8435738	missense	probably benign	0.04
R2205:Tns3	UTSW	11	8531719	missense	probably damaging	1.00
R2319:Tns3	UTSW	11	8541200	missense	probably damaging	1.00
R2830:Tns3	UTSW	11	8435870	missense	probably damaging	1.00
R3720:Tns3	UTSW	11	8492999	missense	probably damaging	1.00
R3765:Tns3	UTSW	11	8451133	missense	probably benign	0.00
R3817:Tns3	UTSW	11	8434619	missense	probably damaging	1.00
R4058:Tns3	UTSW	11	8492275	missense	probably damaging	1.00
R4599:Tns3	UTSW	11	8531747	missense	probably damaging	1.00
R4631:Tns3	UTSW	11	8451119	missense	probably benign	0.30
R4731:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4732:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R4733:Tns3	UTSW	11	8450986	missense	probably benign	0.28
R5472:Tns3	UTSW	11	8451092	missense	probably benign
R5749:Tns3	UTSW	11	8451177	missense	probably benign	0.01
R5807:Tns3	UTSW	11	8493211	missense	probably damaging	1.00
R5844:Tns3	UTSW	11	8434580	missense	probably damaging	1.00
R5942:Tns3	UTSW	11	8435860	missense	probably damaging	1.00
R5982:Tns3	UTSW	11	8492245	missense	probably damaging	0.99
R6025:Tns3	UTSW	11	8492578	missense	possibly damaging	0.93
R6266:Tns3	UTSW	11	8492987	missense	probably damaging	1.00
R6322:Tns3	UTSW	11	8492147	missense	probably benign	0.01
R6536:Tns3	UTSW	11	8434531	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549057	missense	probably damaging	1.00
R6577:Tns3	UTSW	11	8549058	missense	probably damaging	1.00
R6864:Tns3	UTSW	11	8493196	missense	probably damaging	1.00
R6897:Tns3	UTSW	11	8531743	missense	probably damaging	1.00
R7108:Tns3	UTSW	11	8437251	missense	probably benign	0.00
R7443:Tns3	UTSW	11	8451442	missense	probably benign	0.01
R7459:Tns3	UTSW	11	8492793	missense	probably benign	0.16
R7474:Tns3	UTSW	11	8530894	missense	probably damaging	1.00
R7576:Tns3	UTSW	11	8541192	missense	possibly damaging	0.78
R7979:Tns3	UTSW	11	8492701	missense	probably benign	0.01
R8055:Tns3	UTSW	11	8545343	missense	probably damaging	1.00
R8057:Tns3	UTSW	11	8492773	missense	probably benign
R8077:Tns3	UTSW	11	8445667	missense	probably damaging	1.00
R8518:Tns3	UTSW	11	8492971	missense	probably damaging	0.96
R8523:Tns3	UTSW	11	8448779	missense	probably damaging	1.00
R8790:Tns3	UTSW	11	8518273	missense	probably damaging	0.99
R9228:Tns3	UTSW	11	8450094	missense	probably damaging	1.00
R9476:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9510:Tns3	UTSW	11	8445702	missense	probably damaging	0.99
R9594:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9595:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9596:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9624:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
R9629:Tns3	UTSW	11	8451142	missense	possibly damaging	0.79
T0975:Tns3	UTSW	11	8451146	missense	probably benign	0.00
T0975:Tns3	UTSW	11	8479518	missense	probably benign
T0975:Tns3	UTSW	11	8549100	start gained	probably benign
X0005:Tns3	UTSW	11	8451224	missense	probably benign	0.00
X0005:Tns3	UTSW	11	8479518	missense	probably benign
Z1177:Tns3	UTSW	11	8451014	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ATTGCTGATGCCTCTCTGAAC -3'
(R):5'- AGCCAGAACTCTCTCCTGTC -3'

Sequencing Primer
(F):5'- TGATGCCTCTCTGAACAGCCAC -3'
(R):5'- AGAACTCTCTCCTGTCTGATGG -3'

Posted On

2022-04-18