Incidental Mutation 'R9374:Xpo4'
ID 709506
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Name exportin 4
Synonyms B430309A01Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.722) question?
Stock # R9374 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 57814978-57902887 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57828512 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 783 (F783L)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174545]
AlphaFold Q9ESJ0
Predicted Effect possibly damaging
Transcript: ENSMUST00000089482
AA Change: F783L

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: F783L

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000174545
AA Change: F783L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: F783L

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgap21 A T 2: 20,886,397 (GRCm39) V270E probably damaging Het
Blvrb A G 7: 27,158,786 (GRCm39) D62G probably benign Het
Ccdc68 T A 18: 70,089,113 (GRCm39) S219T probably damaging Het
Celf2 G A 2: 6,590,886 (GRCm39) T303I possibly damaging Het
Cep290 T C 10: 100,372,729 (GRCm39) S1176P probably damaging Het
Cpeb2 C A 5: 43,391,584 (GRCm39) S260* probably null Het
Dscam A T 16: 96,857,857 (GRCm39) I51N probably benign Het
Erbb4 G A 1: 68,779,642 (GRCm39) Q45* probably null Het
Fam124a T G 14: 62,843,988 (GRCm39) S499A possibly damaging Het
Hipk3 T C 2: 104,301,850 (GRCm39) N114S probably benign Het
Hnrnph3 T C 10: 62,853,957 (GRCm39) M54V probably benign Het
Map7d1 T C 4: 126,127,429 (GRCm39) E720G unknown Het
Mark2 G T 19: 7,263,263 (GRCm39) T201N possibly damaging Het
Mef2c A G 13: 83,810,461 (GRCm39) N371S probably benign Het
Mgst3 T C 1: 167,205,871 (GRCm39) Y36C probably damaging Het
Mtor C T 4: 148,599,397 (GRCm39) R1482C probably damaging Het
Ndst1 G T 18: 60,845,931 (GRCm39) T126K probably damaging Het
Nkain3 C A 4: 20,778,431 (GRCm39) probably benign Het
Obscn T C 11: 58,922,787 (GRCm39) I5850V possibly damaging Het
Or11g1 C T 14: 50,651,625 (GRCm39) S208F probably benign Het
Or5d14 C T 2: 87,880,509 (GRCm39) W153* probably null Het
Or6k4 A T 1: 173,964,885 (GRCm39) T192S probably benign Het
Pbx1 T C 1: 168,258,910 (GRCm39) D55G possibly damaging Het
Pi4ka T C 16: 17,125,574 (GRCm39) E1187G Het
Pkn1 A T 8: 84,404,367 (GRCm39) N543K probably benign Het
Plin1 T C 7: 79,372,544 (GRCm39) N343D probably benign Het
Prpf4 T C 4: 62,336,131 (GRCm39) V286A probably benign Het
Pyroxd2 A G 19: 42,719,756 (GRCm39) probably null Het
Rbpms A G 8: 34,294,173 (GRCm39) F190S possibly damaging Het
Rpl10a T A 17: 28,548,006 (GRCm39) F49Y possibly damaging Het
Slc32a1 A G 2: 158,455,995 (GRCm39) T217A probably damaging Het
Slco6c1 T C 1: 97,055,827 (GRCm39) S25G probably benign Het
Slitrk5 C T 14: 111,916,496 (GRCm39) T40I probably benign Het
Smchd1 T C 17: 71,718,843 (GRCm39) N842S possibly damaging Het
Sorbs1 G A 19: 40,361,923 (GRCm39) R154* probably null Het
Stc2 A G 11: 31,310,332 (GRCm39) S235P probably benign Het
Tcaf2 C T 6: 42,619,728 (GRCm39) A100T probably benign Het
Tcerg1l T C 7: 137,995,998 (GRCm39) D170G possibly damaging Het
Tcf15 T C 2: 151,986,039 (GRCm39) L165P probably damaging Het
Tle5 T C 10: 81,399,988 (GRCm39) V62A probably damaging Het
Tmem200c G T 17: 69,148,682 (GRCm39) G422W probably damaging Het
Tnfsf13b A G 8: 10,085,391 (GRCm39) I294V possibly damaging Het
Tns3 T A 11: 8,442,606 (GRCm39) T586S probably damaging Het
Unc80 A T 1: 66,629,460 (GRCm39) E1319V possibly damaging Het
Vegfc A G 8: 54,622,180 (GRCm39) I221V possibly damaging Het
Vmn1r86 A T 7: 12,836,781 (GRCm39) Y32N possibly damaging Het
Vmn2r111 T A 17: 22,787,859 (GRCm39) L497F probably benign Het
Wdr49 T C 3: 75,230,931 (GRCm39) D577G probably benign Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57,841,855 (GRCm39) missense probably benign
IGL02537:Xpo4 APN 14 57,831,290 (GRCm39) missense probably benign
IGL02554:Xpo4 APN 14 57,827,545 (GRCm39) missense probably benign 0.00
IGL02826:Xpo4 APN 14 57,866,877 (GRCm39) missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57,855,685 (GRCm39) missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57,822,068 (GRCm39) missense probably null 0.98
R0245:Xpo4 UTSW 14 57,867,697 (GRCm39) missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57,850,731 (GRCm39) missense probably benign 0.07
R0606:Xpo4 UTSW 14 57,875,665 (GRCm39) unclassified probably benign
R0761:Xpo4 UTSW 14 57,850,840 (GRCm39) missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57,841,129 (GRCm39) missense probably benign
R1853:Xpo4 UTSW 14 57,823,364 (GRCm39) missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57,828,328 (GRCm39) missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57,824,101 (GRCm39) missense probably null 0.19
R2035:Xpo4 UTSW 14 57,823,383 (GRCm39) missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57,827,547 (GRCm39) missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57,866,960 (GRCm39) missense probably benign 0.00
R2937:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R2938:Xpo4 UTSW 14 57,841,897 (GRCm39) missense probably benign 0.03
R4066:Xpo4 UTSW 14 57,825,511 (GRCm39) missense probably benign 0.07
R4086:Xpo4 UTSW 14 57,880,490 (GRCm39) intron probably benign
R4373:Xpo4 UTSW 14 57,828,479 (GRCm39) nonsense probably null
R4620:Xpo4 UTSW 14 57,867,782 (GRCm39) missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57,827,565 (GRCm39) missense probably benign 0.01
R4755:Xpo4 UTSW 14 57,855,638 (GRCm39) missense probably benign 0.01
R4831:Xpo4 UTSW 14 57,827,559 (GRCm39) missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57,875,746 (GRCm39) missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57,875,697 (GRCm39) missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57,822,098 (GRCm39) missense probably benign 0.02
R5279:Xpo4 UTSW 14 57,850,866 (GRCm39) missense probably benign 0.37
R5375:Xpo4 UTSW 14 57,875,764 (GRCm39) missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57,828,446 (GRCm39) missense probably benign 0.03
R5936:Xpo4 UTSW 14 57,880,956 (GRCm39) missense probably benign
R6393:Xpo4 UTSW 14 57,875,770 (GRCm39) missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57,850,860 (GRCm39) missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57,819,767 (GRCm39) missense probably benign
R6923:Xpo4 UTSW 14 57,841,168 (GRCm39) missense probably benign 0.19
R7028:Xpo4 UTSW 14 57,834,508 (GRCm39) missense probably benign 0.22
R7442:Xpo4 UTSW 14 57,867,680 (GRCm39) missense probably benign 0.00
R7469:Xpo4 UTSW 14 57,835,436 (GRCm39) missense probably benign
R7490:Xpo4 UTSW 14 57,840,078 (GRCm39) frame shift probably null
R7622:Xpo4 UTSW 14 57,834,468 (GRCm39) missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57,827,416 (GRCm39) missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57,850,806 (GRCm39) missense probably benign 0.00
R7895:Xpo4 UTSW 14 57,840,048 (GRCm39) missense probably benign 0.03
R8000:Xpo4 UTSW 14 57,827,403 (GRCm39) missense probably damaging 1.00
R8372:Xpo4 UTSW 14 57,835,341 (GRCm39) critical splice donor site probably null
R8395:Xpo4 UTSW 14 57,885,924 (GRCm39) missense probably benign 0.01
R8420:Xpo4 UTSW 14 57,841,913 (GRCm39) missense probably damaging 0.99
R8836:Xpo4 UTSW 14 57,902,367 (GRCm39) missense probably benign 0.03
R8841:Xpo4 UTSW 14 57,835,413 (GRCm39) missense probably damaging 0.97
R8989:Xpo4 UTSW 14 57,828,475 (GRCm39) missense probably benign 0.00
R9229:Xpo4 UTSW 14 57,851,156 (GRCm39) missense probably benign
R9551:Xpo4 UTSW 14 57,828,512 (GRCm39) missense possibly damaging 0.94
R9628:Xpo4 UTSW 14 57,842,630 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAATGCAATTGTTAAGGAAGTCC -3'
(R):5'- CACACTATGATGATCCTCAGTATGG -3'

Sequencing Primer
(F):5'- CAGTGATCTCCTGCTTGA -3'
(R):5'- GAGCAATTGAGACCAGCCTGTTC -3'
Posted On 2022-04-18