Incidental Mutation 'R9374:Ndst1'
ID 709515
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene Name N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9374 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 60685978-60713389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 60712859 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 126 (T126K)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
AlphaFold Q3UHN9
Predicted Effect probably damaging
Transcript: ENSMUST00000169273
AA Change: T126K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: T126K

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aes T C 10: 81,564,154 V62A probably damaging Het
Arhgap21 A T 2: 20,881,586 V270E probably damaging Het
Blvrb A G 7: 27,459,361 D62G probably benign Het
Ccdc68 T A 18: 69,956,042 S219T probably damaging Het
Celf2 G A 2: 6,586,075 T303I possibly damaging Het
Cep290 T C 10: 100,536,867 S1176P probably damaging Het
Cpeb2 C A 5: 43,234,241 S260* probably null Het
Dscam A T 16: 97,056,657 I51N probably benign Het
Erbb4 G A 1: 68,740,483 Q45* probably null Het
Fam124a T G 14: 62,606,539 S499A possibly damaging Het
Hipk3 T C 2: 104,471,505 N114S probably benign Het
Hnrnph3 T C 10: 63,018,178 M54V probably benign Het
Map7d1 T C 4: 126,233,636 E720G unknown Het
Mark2 G T 19: 7,285,898 T201N possibly damaging Het
Mef2c A G 13: 83,662,342 N371S probably benign Het
Mgst3 T C 1: 167,378,302 Y36C probably damaging Het
Mtor C T 4: 148,514,940 R1482C probably damaging Het
Nkain3 C A 4: 20,778,431 probably benign Het
Obscn T C 11: 59,031,961 I5850V possibly damaging Het
Olfr1162 C T 2: 88,050,165 W153* probably null Het
Olfr424 A T 1: 174,137,319 T192S probably benign Het
Olfr738 C T 14: 50,414,168 S208F probably benign Het
Pbx1 T C 1: 168,431,341 D55G possibly damaging Het
Pi4ka T C 16: 17,307,710 E1187G Het
Pkn1 A T 8: 83,677,738 N543K probably benign Het
Plin1 T C 7: 79,722,796 N343D probably benign Het
Prpf4 T C 4: 62,417,894 V286A probably benign Het
Pyroxd2 A G 19: 42,731,317 probably null Het
Rbpms A G 8: 33,804,145 F190S possibly damaging Het
Rpl10a T A 17: 28,329,032 F49Y possibly damaging Het
Slc32a1 A G 2: 158,614,075 T217A probably damaging Het
Slco6c1 T C 1: 97,128,102 S25G probably benign Het
Slitrk5 C T 14: 111,679,064 T40I probably benign Het
Smchd1 T C 17: 71,411,848 N842S possibly damaging Het
Sorbs1 G A 19: 40,373,479 R154* probably null Het
Stc2 A G 11: 31,360,332 S235P probably benign Het
Tcaf2 C T 6: 42,642,794 A100T probably benign Het
Tcerg1l T C 7: 138,394,269 D170G possibly damaging Het
Tcf15 T C 2: 152,144,119 L165P probably damaging Het
Tmem200c G T 17: 68,841,687 G422W probably damaging Het
Tnfsf13b A G 8: 10,035,391 I294V possibly damaging Het
Tns3 T A 11: 8,492,606 T586S probably damaging Het
Unc80 A T 1: 66,590,301 E1319V possibly damaging Het
Vegfc A G 8: 54,169,145 I221V possibly damaging Het
Vmn1r86 A T 7: 13,102,854 Y32N possibly damaging Het
Vmn2r111 T A 17: 22,568,878 L497F probably benign Het
Wdr49 T C 3: 75,323,624 D577G probably benign Het
Xpo4 A G 14: 57,591,055 F783L possibly damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R5968:Ndst1 UTSW 18 60713076 missense probably benign
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
R8918:Ndst1 UTSW 18 60692011 missense probably benign 0.00
R8951:Ndst1 UTSW 18 60697124 missense probably benign
R9187:Ndst1 UTSW 18 60691196 missense probably benign 0.03
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAACTGATCTGTGCTTAGC -3'
(R):5'- TGCTTCCGAGTCTGACTGTG -3'

Sequencing Primer
(F):5'- GCTTAGCTAGCGAGTGCAG -3'
(R):5'- CGAGTCTGACTGTGGGGAC -3'
Posted On 2022-04-18