Incidental Mutation 'R9375:Kcne4'
ID 709521
Institutional Source Beutler Lab
Gene Symbol Kcne4
Ensembl Gene ENSMUSG00000047330
Gene Name potassium voltage-gated channel, Isk-related subfamily, gene 4
Synonyms MiRP3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock # R9375 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 78816758-78820028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78817906 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 90 (M90I)
Ref Sequence ENSEMBL: ENSMUSP00000055415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057262] [ENSMUST00000187432]
AlphaFold Q9WTW3
Predicted Effect probably benign
Transcript: ENSMUST00000057262
AA Change: M90I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055415
Gene: ENSMUSG00000047330
AA Change: M90I

DomainStartEndE-ValueType
Pfam:ISK_Channel 4 86 2.3e-11 PFAM
low complexity region 124 131 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187432
SMART Domains Protein: ENSMUSP00000140235
Gene: ENSMUSG00000047330

DomainStartEndE-ValueType
Pfam:ISK_Channel 6 64 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, isk-related subfamily. This member is a type I membrane protein, and a beta subunit that assembles with a potassium channel alpha-subunit to modulate the gating kinetics and enhance stability of the multimeric complex. This gene is prominently expressed in the embryo and in adult uterus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,184,701 D549G probably benign Het
Aamdc A G 7: 97,550,695 V120A probably benign Het
Acp2 A T 2: 91,206,829 Q251L probably benign Het
AI597479 C T 1: 43,111,345 A205V possibly damaging Het
Apob A G 12: 7,979,261 T44A possibly damaging Het
Arhgap18 G A 10: 26,772,614 V11M probably damaging Het
Arhgef10l T G 4: 140,591,954 H156P probably benign Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
BC053393 T A 11: 46,577,419 C107S probably damaging Het
Chd9 G A 8: 90,998,707 probably null Het
Cngb1 T C 8: 95,299,722 K144E unknown Het
Ctgf A T 10: 24,597,603 M347L possibly damaging Het
Cyp4f17 A G 17: 32,528,772 T485A probably damaging Het
Dcaf6 T A 1: 165,357,483 Y480F probably damaging Het
Defa30 C T 8: 21,134,670 T3I probably damaging Het
Dmxl1 T A 18: 49,958,410 W2854R probably damaging Het
Dnah11 G A 12: 117,920,968 T3783I possibly damaging Het
Dync1i1 T A 6: 5,913,443 F225L possibly damaging Het
Elp6 T A 9: 110,315,784 Y119* probably null Het
Enpep A T 3: 129,331,880 M201K probably benign Het
Fam161a A T 11: 23,020,661 R280W probably damaging Het
Fam98a T C 17: 75,541,335 N128S possibly damaging Het
Fpgt A T 3: 155,087,297 D364E probably benign Het
G3bp1 T A 11: 55,499,613 M448K probably damaging Het
Gadd45b T C 10: 80,930,450 M16T probably benign Het
Gdi2 A T 13: 3,564,869 I383F probably benign Het
Gm9268 C T 7: 43,024,075 P193S possibly damaging Het
Gm9833 T C 3: 10,088,731 S187P probably benign Het
H2-Bl T C 17: 36,081,101 T27A possibly damaging Het
Igtp T G 11: 58,206,200 L66V probably damaging Het
Lmo7 T A 14: 101,898,687 M732K probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mast4 T G 13: 102,781,245 S552R probably damaging Het
Mff A T 1: 82,729,286 M11L probably benign Het
Mterf2 T C 10: 85,120,463 E99G probably damaging Het
Myom2 T A 8: 15,099,210 N560K probably damaging Het
Nab2 A G 10: 127,664,711 S171P probably damaging Het
Nhlrc3 T C 3: 53,461,769 N83S possibly damaging Het
Nod2 A T 8: 88,664,405 I447F probably damaging Het
Npat T A 9: 53,563,156 D749E possibly damaging Het
Nxph4 A G 10: 127,526,762 S87P probably benign Het
Olfr1392 T A 11: 49,294,075 Y251* probably null Het
Olfr1497 T A 19: 13,794,850 T254S probably damaging Het
Olfr641 G T 7: 104,040,066 R90L possibly damaging Het
Olfr74 G A 2: 87,974,182 T161M possibly damaging Het
Olfr782 T A 10: 129,351,120 S186T probably damaging Het
Pcdha3 G A 18: 36,946,300 V32I probably benign Het
Pcdhgc3 A T 18: 37,806,638 T31S probably benign Het
Phldb3 A G 7: 24,623,872 R391G probably damaging Het
Piezo1 A G 8: 122,501,865 V257A Het
Pip5k1b T A 19: 24,439,078 Q15L probably benign Het
Plxnc1 T C 10: 94,813,231 N1229D probably benign Het
Ptpn12 A G 5: 21,019,214 V127A probably benign Het
Ptprr T A 10: 116,273,819 V655D probably benign Het
Rbbp8 A G 18: 11,705,831 T190A probably benign Het
Rnf17 T A 14: 56,482,122 V943E probably damaging Het
Rnpc3 C T 3: 113,611,264 G414D probably damaging Het
Robo4 T A 9: 37,404,862 N387K probably damaging Het
Sall4 G A 2: 168,755,861 T353M probably damaging Het
Serpinb13 T C 1: 106,982,267 I38T probably damaging Het
Sgsm1 A T 5: 113,274,273 I218N unknown Het
Sntg2 T A 12: 30,243,344 probably null Het
Taf1c G A 8: 119,598,654 S823F probably damaging Het
Tldc1 G A 8: 119,771,357 A136V probably benign Het
Trhde T G 10: 114,408,693 I963L probably damaging Het
Trim43b T C 9: 89,085,566 Y339C probably damaging Het
Trp53 T A 11: 69,589,711 probably null Het
Tubg2 T C 11: 101,160,795 V282A probably benign Het
Ube2g1 C T 11: 72,663,117 probably benign Het
Usp34 C A 11: 23,487,203 A3341E Het
Vmn2r12 T A 5: 109,086,120 H742L probably damaging Het
Vmn2r24 T C 6: 123,815,583 V623A probably damaging Het
Vmn2r5 A T 3: 64,503,895 D417E probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zfp2 T C 11: 50,900,215 S334G probably damaging Het
Other mutations in Kcne4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Kcne4 APN 1 78817808 missense possibly damaging 0.89
IGL03047:Kcne4 UTSW 1 78817778 missense possibly damaging 0.64
R2091:Kcne4 UTSW 1 78817907 missense probably benign 0.00
R2426:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R3405:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R3406:Kcne4 UTSW 1 78817971 missense possibly damaging 0.94
R4158:Kcne4 UTSW 1 78818102 missense probably benign 0.01
R4159:Kcne4 UTSW 1 78818102 missense probably benign 0.01
R4414:Kcne4 UTSW 1 78817934 missense probably benign
R6959:Kcne4 UTSW 1 78817886 missense probably benign 0.01
R8461:Kcne4 UTSW 1 78817716 missense probably benign 0.26
R9020:Kcne4 UTSW 1 78817708 missense probably benign 0.00
R9311:Kcne4 UTSW 1 78818107 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTAACAGCAGTGGTAATGGC -3'
(R):5'- TCACTGCTGTCGTTGAGAGG -3'

Sequencing Primer
(F):5'- GCAGTGGTAATGGCAATGAATACTTC -3'
(R):5'- AGGTCTCCTCCAGCTCG -3'
Posted On 2022-04-18