Incidental Mutation 'R9375:Serpinb13'
ID 709523
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HURPIN, headpin, HUR7, PI13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R9375 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 106980984-107001195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106982267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 38 (I38T)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably damaging
Transcript: ENSMUST00000027564
AA Change: I38T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: I38T

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136766
AA Change: I38T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: I38T

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,184,701 D549G probably benign Het
Aamdc A G 7: 97,550,695 V120A probably benign Het
Acp2 A T 2: 91,206,829 Q251L probably benign Het
AI597479 C T 1: 43,111,345 A205V possibly damaging Het
Apob A G 12: 7,979,261 T44A possibly damaging Het
Arhgap18 G A 10: 26,772,614 V11M probably damaging Het
Arhgef10l T G 4: 140,591,954 H156P probably benign Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
BC053393 T A 11: 46,577,419 C107S probably damaging Het
Chd9 G A 8: 90,998,707 probably null Het
Cngb1 T C 8: 95,299,722 K144E unknown Het
Ctgf A T 10: 24,597,603 M347L possibly damaging Het
Cyp4f17 A G 17: 32,528,772 T485A probably damaging Het
Dcaf6 T A 1: 165,357,483 Y480F probably damaging Het
Defa30 C T 8: 21,134,670 T3I probably damaging Het
Dmxl1 T A 18: 49,958,410 W2854R probably damaging Het
Dnah11 G A 12: 117,920,968 T3783I possibly damaging Het
Dync1i1 T A 6: 5,913,443 F225L possibly damaging Het
Elp6 T A 9: 110,315,784 Y119* probably null Het
Enpep A T 3: 129,331,880 M201K probably benign Het
Fam161a A T 11: 23,020,661 R280W probably damaging Het
Fam98a T C 17: 75,541,335 N128S possibly damaging Het
Fpgt A T 3: 155,087,297 D364E probably benign Het
G3bp1 T A 11: 55,499,613 M448K probably damaging Het
Gadd45b T C 10: 80,930,450 M16T probably benign Het
Gdi2 A T 13: 3,564,869 I383F probably benign Het
Gm9268 C T 7: 43,024,075 P193S possibly damaging Het
Gm9833 T C 3: 10,088,731 S187P probably benign Het
H2-Bl T C 17: 36,081,101 T27A possibly damaging Het
Igtp T G 11: 58,206,200 L66V probably damaging Het
Kcne4 G A 1: 78,817,906 M90I probably benign Het
Lmo7 T A 14: 101,898,687 M732K probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mast4 T G 13: 102,781,245 S552R probably damaging Het
Mff A T 1: 82,729,286 M11L probably benign Het
Mterf2 T C 10: 85,120,463 E99G probably damaging Het
Myom2 T A 8: 15,099,210 N560K probably damaging Het
Nab2 A G 10: 127,664,711 S171P probably damaging Het
Nhlrc3 T C 3: 53,461,769 N83S possibly damaging Het
Nod2 A T 8: 88,664,405 I447F probably damaging Het
Npat T A 9: 53,563,156 D749E possibly damaging Het
Nxph4 A G 10: 127,526,762 S87P probably benign Het
Olfr1392 T A 11: 49,294,075 Y251* probably null Het
Olfr1497 T A 19: 13,794,850 T254S probably damaging Het
Olfr641 G T 7: 104,040,066 R90L possibly damaging Het
Olfr74 G A 2: 87,974,182 T161M possibly damaging Het
Olfr782 T A 10: 129,351,120 S186T probably damaging Het
Pcdha3 G A 18: 36,946,300 V32I probably benign Het
Pcdhgc3 A T 18: 37,806,638 T31S probably benign Het
Phldb3 A G 7: 24,623,872 R391G probably damaging Het
Piezo1 A G 8: 122,501,865 V257A Het
Pip5k1b T A 19: 24,439,078 Q15L probably benign Het
Plxnc1 T C 10: 94,813,231 N1229D probably benign Het
Ptpn12 A G 5: 21,019,214 V127A probably benign Het
Ptprr T A 10: 116,273,819 V655D probably benign Het
Rbbp8 A G 18: 11,705,831 T190A probably benign Het
Rnf17 T A 14: 56,482,122 V943E probably damaging Het
Rnpc3 C T 3: 113,611,264 G414D probably damaging Het
Robo4 T A 9: 37,404,862 N387K probably damaging Het
Sall4 G A 2: 168,755,861 T353M probably damaging Het
Sgsm1 A T 5: 113,274,273 I218N unknown Het
Sntg2 T A 12: 30,243,344 probably null Het
Taf1c G A 8: 119,598,654 S823F probably damaging Het
Tldc1 G A 8: 119,771,357 A136V probably benign Het
Trhde T G 10: 114,408,693 I963L probably damaging Het
Trim43b T C 9: 89,085,566 Y339C probably damaging Het
Trp53 T A 11: 69,589,711 probably null Het
Tubg2 T C 11: 101,160,795 V282A probably benign Het
Ube2g1 C T 11: 72,663,117 probably benign Het
Usp34 C A 11: 23,487,203 A3341E Het
Vmn2r12 T A 5: 109,086,120 H742L probably damaging Het
Vmn2r24 T C 6: 123,815,583 V623A probably damaging Het
Vmn2r5 A T 3: 64,503,895 D417E probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zfp2 T C 11: 50,900,215 S334G probably damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106999021 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106982185 missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6720:Serpinb13 UTSW 1 106994062 missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
R8907:Serpinb13 UTSW 1 107000789 missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 107000435 missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106995789 missense probably benign 0.01
R9350:Serpinb13 UTSW 1 106995832 nonsense probably null
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCAGTCCAGAAGTGGTGTTG -3'
(R):5'- TCATACCCCTACTTAAAGGAATGCC -3'

Sequencing Primer
(F):5'- CCAGAAGTGGTGTTGATTGTTATTGC -3'
(R):5'- AGGCCTTCCCTGACAGACTTG -3'
Posted On 2022-04-18