Mutagenetix > Incidental Mutations

Incidental Mutation 'R9375:Serpinb13'

709523

Institutional Source

Beutler Lab

Gene Symbol

Serpinb13

Ensembl Gene

ENSMUSG00000048775

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13

Synonyms

HURPIN, headpin, HUR7, PI13

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R9375 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

106980984-107001195 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106982267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 38 (I38T)

Ref Sequence

ENSEMBL: ENSMUSP00000027564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]

AlphaFold

Q8CDC0

Predicted Effect

probably damaging
Transcript: ENSMUST00000027564
AA Change: I38T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: I38T

Domain	Start	End	E-Value	Type
SERPIN	13	389	1.55e-144	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136766
AA Change: I38T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775
AA Change: I38T

Domain	Start	End	E-Value	Type
Pfam:Serpin	6	94	1.1e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900026A02Rik	T	C	5: 113,184,701	D549G	probably benign	Het
Aamdc	A	G	7: 97,550,695	V120A	probably benign	Het
Acp2	A	T	2: 91,206,829	Q251L	probably benign	Het
AI597479	C	T	1: 43,111,345	A205V	possibly damaging	Het
Apob	A	G	12: 7,979,261	T44A	possibly damaging	Het
Arhgap18	G	A	10: 26,772,614	V11M	probably damaging	Het
Arhgef10l	T	G	4: 140,591,954	H156P	probably benign	Het
Aste1	G	A	9: 105,396,681	C40Y	probably benign	Het
BC053393	T	A	11: 46,577,419	C107S	probably damaging	Het
Chd9	G	A	8: 90,998,707		probably null	Het
Cngb1	T	C	8: 95,299,722	K144E	unknown	Het
Ctgf	A	T	10: 24,597,603	M347L	possibly damaging	Het
Cyp4f17	A	G	17: 32,528,772	T485A	probably damaging	Het
Dcaf6	T	A	1: 165,357,483	Y480F	probably damaging	Het
Defa30	C	T	8: 21,134,670	T3I	probably damaging	Het
Dmxl1	T	A	18: 49,958,410	W2854R	probably damaging	Het
Dnah11	G	A	12: 117,920,968	T3783I	possibly damaging	Het
Dync1i1	T	A	6: 5,913,443	F225L	possibly damaging	Het
Elp6	T	A	9: 110,315,784	Y119*	probably null	Het
Enpep	A	T	3: 129,331,880	M201K	probably benign	Het
Fam161a	A	T	11: 23,020,661	R280W	probably damaging	Het
Fam98a	T	C	17: 75,541,335	N128S	possibly damaging	Het
Fpgt	A	T	3: 155,087,297	D364E	probably benign	Het
G3bp1	T	A	11: 55,499,613	M448K	probably damaging	Het
Gadd45b	T	C	10: 80,930,450	M16T	probably benign	Het
Gdi2	A	T	13: 3,564,869	I383F	probably benign	Het
Gm9268	C	T	7: 43,024,075	P193S	possibly damaging	Het
Gm9833	T	C	3: 10,088,731	S187P	probably benign	Het
H2-Bl	T	C	17: 36,081,101	T27A	possibly damaging	Het
Igtp	T	G	11: 58,206,200	L66V	probably damaging	Het
Kcne4	G	A	1: 78,817,906	M90I	probably benign	Het
Lmo7	T	A	14: 101,898,687	M732K	probably damaging	Het
Ltbp2	G	A	12: 84,791,090	P1192L	probably benign	Het
Mast4	T	G	13: 102,781,245	S552R	probably damaging	Het
Mff	A	T	1: 82,729,286	M11L	probably benign	Het
Mterf2	T	C	10: 85,120,463	E99G	probably damaging	Het
Myom2	T	A	8: 15,099,210	N560K	probably damaging	Het
Nab2	A	G	10: 127,664,711	S171P	probably damaging	Het
Nhlrc3	T	C	3: 53,461,769	N83S	possibly damaging	Het
Nod2	A	T	8: 88,664,405	I447F	probably damaging	Het
Npat	T	A	9: 53,563,156	D749E	possibly damaging	Het
Nxph4	A	G	10: 127,526,762	S87P	probably benign	Het
Olfr1392	T	A	11: 49,294,075	Y251*	probably null	Het
Olfr1497	T	A	19: 13,794,850	T254S	probably damaging	Het
Olfr641	G	T	7: 104,040,066	R90L	possibly damaging	Het
Olfr74	G	A	2: 87,974,182	T161M	possibly damaging	Het
Olfr782	T	A	10: 129,351,120	S186T	probably damaging	Het
Pcdha3	G	A	18: 36,946,300	V32I	probably benign	Het
Pcdhgc3	A	T	18: 37,806,638	T31S	probably benign	Het
Phldb3	A	G	7: 24,623,872	R391G	probably damaging	Het
Piezo1	A	G	8: 122,501,865	V257A		Het
Pip5k1b	T	A	19: 24,439,078	Q15L	probably benign	Het
Plxnc1	T	C	10: 94,813,231	N1229D	probably benign	Het
Ptpn12	A	G	5: 21,019,214	V127A	probably benign	Het
Ptprr	T	A	10: 116,273,819	V655D	probably benign	Het
Rbbp8	A	G	18: 11,705,831	T190A	probably benign	Het
Rnf17	T	A	14: 56,482,122	V943E	probably damaging	Het
Rnpc3	C	T	3: 113,611,264	G414D	probably damaging	Het
Robo4	T	A	9: 37,404,862	N387K	probably damaging	Het
Sall4	G	A	2: 168,755,861	T353M	probably damaging	Het
Sgsm1	A	T	5: 113,274,273	I218N	unknown	Het
Sntg2	T	A	12: 30,243,344		probably null	Het
Taf1c	G	A	8: 119,598,654	S823F	probably damaging	Het
Tldc1	G	A	8: 119,771,357	A136V	probably benign	Het
Trhde	T	G	10: 114,408,693	I963L	probably damaging	Het
Trim43b	T	C	9: 89,085,566	Y339C	probably damaging	Het
Trp53	T	A	11: 69,589,711		probably null	Het
Tubg2	T	C	11: 101,160,795	V282A	probably benign	Het
Ube2g1	C	T	11: 72,663,117		probably benign	Het
Usp34	C	A	11: 23,487,203	A3341E		Het
Vmn2r12	T	A	5: 109,086,120	H742L	probably damaging	Het
Vmn2r24	T	C	6: 123,815,583	V623A	probably damaging	Het
Vmn2r5	A	T	3: 64,503,895	D417E	probably damaging	Het
Xirp2	A	T	2: 67,511,774	D1453V	probably damaging	Het
Zfp2	T	C	11: 50,900,215	S334G	probably damaging	Het

Other mutations in Serpinb13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00558:Serpinb13	APN	1	106996380	missense	probably damaging	1.00
IGL01758:Serpinb13	APN	1	107000754	missense	probably damaging	1.00
IGL02078:Serpinb13	APN	1	106998958	missense	probably damaging	0.99
IGL02183:Serpinb13	APN	1	106998910	missense	probably damaging	1.00
PIT4651001:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R0683:Serpinb13	UTSW	1	106999021	missense	probably damaging	1.00
R1263:Serpinb13	UTSW	1	107000736	missense	probably damaging	0.97
R1535:Serpinb13	UTSW	1	106982156	start codon destroyed	probably null	1.00
R1929:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2271:Serpinb13	UTSW	1	106999026	missense	possibly damaging	0.85
R2655:Serpinb13	UTSW	1	107000427	missense	probably damaging	0.99
R3115:Serpinb13	UTSW	1	106982838	missense	probably null	0.15
R3418:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3419:Serpinb13	UTSW	1	106998927	missense	probably damaging	0.99
R3883:Serpinb13	UTSW	1	106998572	missense	probably benign	0.37
R4664:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4666:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4689:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4690:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4725:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4728:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R4847:Serpinb13	UTSW	1	106982844	missense	probably damaging	1.00
R5249:Serpinb13	UTSW	1	106998697	missense	probably damaging	1.00
R5501:Serpinb13	UTSW	1	106982185	missense	possibly damaging	0.81
R5507:Serpinb13	UTSW	1	106998602	missense	probably benign	0.00
R6015:Serpinb13	UTSW	1	107000607	missense	probably benign	0.00
R6363:Serpinb13	UTSW	1	107000774	nonsense	probably null
R6720:Serpinb13	UTSW	1	106994062	missense	probably benign	0.12
R6847:Serpinb13	UTSW	1	106998933	missense	probably benign	0.24
R7237:Serpinb13	UTSW	1	106998949	missense	probably damaging	1.00
R8907:Serpinb13	UTSW	1	107000789	missense	probably damaging	1.00
R8966:Serpinb13	UTSW	1	107000435	missense	probably damaging	1.00
R9011:Serpinb13	UTSW	1	106995789	missense	probably benign	0.01
R9350:Serpinb13	UTSW	1	106995832	nonsense	probably null
Z1177:Serpinb13	UTSW	1	106982303	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CCAGTCCAGAAGTGGTGTTG -3'
(R):5'- TCATACCCCTACTTAAAGGAATGCC -3'

Sequencing Primer
(F):5'- CCAGAAGTGGTGTTGATTGTTATTGC -3'
(R):5'- AGGCCTTCCCTGACAGACTTG -3'

Posted On

2022-04-18