Incidental Mutation 'R9375:Vmn2r5'
ID 709531
Institutional Source Beutler Lab
Gene Symbol Vmn2r5
Ensembl Gene ENSMUSG00000068999
Gene Name vomeronasal 2, receptor 5
Synonyms EG667060
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock # R9375 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 64490821-64509735 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 64503895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 417 (D417E)
Ref Sequence ENSEMBL: ENSMUSP00000135592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170270] [ENSMUST00000177184]
AlphaFold K7N788
Predicted Effect probably damaging
Transcript: ENSMUST00000170270
AA Change: D330E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131925
Gene: ENSMUSG00000068999
AA Change: D330E

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 9.9e-78 PFAM
Pfam:NCD3G 458 511 8.5e-18 PFAM
Pfam:7tm_3 542 779 2.3e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177184
AA Change: D417E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135592
Gene: ENSMUSG00000068999
AA Change: D417E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 86 503 1.8e-80 PFAM
Pfam:NCD3G 545 598 1e-14 PFAM
Pfam:7tm_3 631 865 1.4e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,184,701 D549G probably benign Het
Aamdc A G 7: 97,550,695 V120A probably benign Het
Acp2 A T 2: 91,206,829 Q251L probably benign Het
AI597479 C T 1: 43,111,345 A205V possibly damaging Het
Apob A G 12: 7,979,261 T44A possibly damaging Het
Arhgap18 G A 10: 26,772,614 V11M probably damaging Het
Arhgef10l T G 4: 140,591,954 H156P probably benign Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
BC053393 T A 11: 46,577,419 C107S probably damaging Het
Chd9 G A 8: 90,998,707 probably null Het
Cngb1 T C 8: 95,299,722 K144E unknown Het
Ctgf A T 10: 24,597,603 M347L possibly damaging Het
Cyp4f17 A G 17: 32,528,772 T485A probably damaging Het
Dcaf6 T A 1: 165,357,483 Y480F probably damaging Het
Defa30 C T 8: 21,134,670 T3I probably damaging Het
Dmxl1 T A 18: 49,958,410 W2854R probably damaging Het
Dnah11 G A 12: 117,920,968 T3783I possibly damaging Het
Dync1i1 T A 6: 5,913,443 F225L possibly damaging Het
Elp6 T A 9: 110,315,784 Y119* probably null Het
Enpep A T 3: 129,331,880 M201K probably benign Het
Fam161a A T 11: 23,020,661 R280W probably damaging Het
Fam98a T C 17: 75,541,335 N128S possibly damaging Het
Fpgt A T 3: 155,087,297 D364E probably benign Het
G3bp1 T A 11: 55,499,613 M448K probably damaging Het
Gadd45b T C 10: 80,930,450 M16T probably benign Het
Gdi2 A T 13: 3,564,869 I383F probably benign Het
Gm9268 C T 7: 43,024,075 P193S possibly damaging Het
Gm9833 T C 3: 10,088,731 S187P probably benign Het
H2-Bl T C 17: 36,081,101 T27A possibly damaging Het
Igtp T G 11: 58,206,200 L66V probably damaging Het
Kcne4 G A 1: 78,817,906 M90I probably benign Het
Lmo7 T A 14: 101,898,687 M732K probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mast4 T G 13: 102,781,245 S552R probably damaging Het
Mff A T 1: 82,729,286 M11L probably benign Het
Mterf2 T C 10: 85,120,463 E99G probably damaging Het
Myom2 T A 8: 15,099,210 N560K probably damaging Het
Nab2 A G 10: 127,664,711 S171P probably damaging Het
Nhlrc3 T C 3: 53,461,769 N83S possibly damaging Het
Nod2 A T 8: 88,664,405 I447F probably damaging Het
Npat T A 9: 53,563,156 D749E possibly damaging Het
Nxph4 A G 10: 127,526,762 S87P probably benign Het
Olfr1392 T A 11: 49,294,075 Y251* probably null Het
Olfr1497 T A 19: 13,794,850 T254S probably damaging Het
Olfr641 G T 7: 104,040,066 R90L possibly damaging Het
Olfr74 G A 2: 87,974,182 T161M possibly damaging Het
Olfr782 T A 10: 129,351,120 S186T probably damaging Het
Pcdha3 G A 18: 36,946,300 V32I probably benign Het
Pcdhgc3 A T 18: 37,806,638 T31S probably benign Het
Phldb3 A G 7: 24,623,872 R391G probably damaging Het
Piezo1 A G 8: 122,501,865 V257A Het
Pip5k1b T A 19: 24,439,078 Q15L probably benign Het
Plxnc1 T C 10: 94,813,231 N1229D probably benign Het
Ptpn12 A G 5: 21,019,214 V127A probably benign Het
Ptprr T A 10: 116,273,819 V655D probably benign Het
Rbbp8 A G 18: 11,705,831 T190A probably benign Het
Rnf17 T A 14: 56,482,122 V943E probably damaging Het
Rnpc3 C T 3: 113,611,264 G414D probably damaging Het
Robo4 T A 9: 37,404,862 N387K probably damaging Het
Sall4 G A 2: 168,755,861 T353M probably damaging Het
Serpinb13 T C 1: 106,982,267 I38T probably damaging Het
Sgsm1 A T 5: 113,274,273 I218N unknown Het
Sntg2 T A 12: 30,243,344 probably null Het
Taf1c G A 8: 119,598,654 S823F probably damaging Het
Tldc1 G A 8: 119,771,357 A136V probably benign Het
Trhde T G 10: 114,408,693 I963L probably damaging Het
Trim43b T C 9: 89,085,566 Y339C probably damaging Het
Trp53 T A 11: 69,589,711 probably null Het
Tubg2 T C 11: 101,160,795 V282A probably benign Het
Ube2g1 C T 11: 72,663,117 probably benign Het
Usp34 C A 11: 23,487,203 A3341E Het
Vmn2r12 T A 5: 109,086,120 H742L probably damaging Het
Vmn2r24 T C 6: 123,815,583 V623A probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zfp2 T C 11: 50,900,215 S334G probably damaging Het
Other mutations in Vmn2r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Vmn2r5 APN 3 64491413 missense possibly damaging 0.67
IGL01139:Vmn2r5 APN 3 64491405 missense probably benign 0.28
IGL03293:Vmn2r5 APN 3 64491326 missense probably benign 0.01
PIT4581001:Vmn2r5 UTSW 3 64503927 nonsense probably null
R0063:Vmn2r5 UTSW 3 64503800 missense probably benign 0.01
R0142:Vmn2r5 UTSW 3 64492588 missense probably damaging 1.00
R0193:Vmn2r5 UTSW 3 64491530 missense possibly damaging 0.91
R0219:Vmn2r5 UTSW 3 64504313 missense probably damaging 0.99
R0313:Vmn2r5 UTSW 3 64503827 missense probably benign
R0620:Vmn2r5 UTSW 3 64503814 nonsense probably null
R0726:Vmn2r5 UTSW 3 64503765 missense probably benign 0.01
R1073:Vmn2r5 UTSW 3 64491305 nonsense probably null
R1549:Vmn2r5 UTSW 3 64504000 missense probably damaging 1.00
R1581:Vmn2r5 UTSW 3 64491219 missense probably damaging 1.00
R1624:Vmn2r5 UTSW 3 64509695 missense probably benign 0.19
R1973:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1974:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1975:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R1977:Vmn2r5 UTSW 3 64504221 missense probably damaging 1.00
R2189:Vmn2r5 UTSW 3 64509593 missense probably benign 0.27
R2484:Vmn2r5 UTSW 3 64503971 missense possibly damaging 0.94
R4573:Vmn2r5 UTSW 3 64503918 missense probably damaging 0.98
R5243:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5384:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5385:Vmn2r5 UTSW 3 64509510 missense probably benign 0.02
R5587:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5588:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5589:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5590:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R5739:Vmn2r5 UTSW 3 64504076 missense probably damaging 1.00
R6113:Vmn2r5 UTSW 3 64491399 missense probably benign 0.03
R6739:Vmn2r5 UTSW 3 64491216 missense probably damaging 0.97
R7106:Vmn2r5 UTSW 3 64491683 missense probably benign 0.05
R7304:Vmn2r5 UTSW 3 64504250 missense probably damaging 0.97
R7402:Vmn2r5 UTSW 3 64495755 missense probably benign 0.05
R7477:Vmn2r5 UTSW 3 64491639 missense probably damaging 1.00
R7571:Vmn2r5 UTSW 3 64504404 missense probably damaging 1.00
R7678:Vmn2r5 UTSW 3 64509522 missense probably benign
R7874:Vmn2r5 UTSW 3 64491032 missense probably damaging 1.00
R8110:Vmn2r5 UTSW 3 64491288 missense probably benign 0.00
R8223:Vmn2r5 UTSW 3 64491305 nonsense probably null
R8767:Vmn2r5 UTSW 3 64507682 missense possibly damaging 0.79
R8896:Vmn2r5 UTSW 3 64503782 missense probably benign 0.00
R8948:Vmn2r5 UTSW 3 64491101 missense probably damaging 1.00
R8950:Vmn2r5 UTSW 3 64491101 missense probably damaging 1.00
R8962:Vmn2r5 UTSW 3 64491143 missense probably damaging 1.00
R9012:Vmn2r5 UTSW 3 64504494 missense probably damaging 1.00
R9109:Vmn2r5 UTSW 3 64503990 missense possibly damaging 0.58
R9126:Vmn2r5 UTSW 3 64491738 missense probably benign 0.13
R9192:Vmn2r5 UTSW 3 64491517 nonsense probably null
R9221:Vmn2r5 UTSW 3 64504300 nonsense probably null
R9529:Vmn2r5 UTSW 3 64492597 missense probably benign 0.06
Z1088:Vmn2r5 UTSW 3 64509542 missense probably benign 0.02
Z1177:Vmn2r5 UTSW 3 64491051 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCAGCAAACCTTGGTTTTACC -3'
(R):5'- CTAGCAAGGATCCAAATGATGTC -3'

Sequencing Primer
(F):5'- ACCCCATGCTCTATAATAGGGTC -3'
(R):5'- GCAAGGATCCAAATGATGTCTTGACC -3'
Posted On 2022-04-18