Incidental Mutation 'R9375:Taf1c'
ID 709551
Institutional Source Beutler Lab
Gene Symbol Taf1c
Ensembl Gene ENSMUSG00000031832
Gene Name TATA-box binding protein associated factor, RNA polymerase I, C
Synonyms mTAFI95
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R9375 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 119597871-119605222 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119598654 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Phenylalanine at position 823 (S823F)
Ref Sequence ENSEMBL: ENSMUSP00000090789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093099] [ENSMUST00000093100] [ENSMUST00000147964]
AlphaFold Q6PDZ2
Predicted Effect probably damaging
Transcript: ENSMUST00000093099
AA Change: S823F

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090789
Gene: ENSMUSG00000031832
AA Change: S823F

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
SCOP:d1k32a3 253 389 2e-3 SMART
Blast:WD40 301 340 2e-15 BLAST
low complexity region 457 472 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 520 535 N/A INTRINSIC
low complexity region 724 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093100
SMART Domains Protein: ENSMUSP00000090790
Gene: ENSMUSG00000031831

DomainStartEndE-ValueType
Pfam:LRR_9 115 298 5.7e-10 PFAM
low complexity region 322 332 N/A INTRINSIC
low complexity region 482 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147964
SMART Domains Protein: ENSMUSP00000118480
Gene: ENSMUSG00000031832

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase I requires the formation of a complex composed of the TATA-binding protein (TBP) and three TBP-associated factors (TAFs) specific for RNA polymerase I. This complex, known as SL1, binds to the core promoter of ribosomal RNA genes to position the polymerase properly and acts as a channel for regulatory signals. This gene encodes the largest SL1-specific TAF. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2011]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,184,701 D549G probably benign Het
Aamdc A G 7: 97,550,695 V120A probably benign Het
Acp2 A T 2: 91,206,829 Q251L probably benign Het
AI597479 C T 1: 43,111,345 A205V possibly damaging Het
Apob A G 12: 7,979,261 T44A possibly damaging Het
Arhgap18 G A 10: 26,772,614 V11M probably damaging Het
Arhgef10l T G 4: 140,591,954 H156P probably benign Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
BC053393 T A 11: 46,577,419 C107S probably damaging Het
Chd9 G A 8: 90,998,707 probably null Het
Cngb1 T C 8: 95,299,722 K144E unknown Het
Ctgf A T 10: 24,597,603 M347L possibly damaging Het
Cyp4f17 A G 17: 32,528,772 T485A probably damaging Het
Dcaf6 T A 1: 165,357,483 Y480F probably damaging Het
Defa30 C T 8: 21,134,670 T3I probably damaging Het
Dmxl1 T A 18: 49,958,410 W2854R probably damaging Het
Dnah11 G A 12: 117,920,968 T3783I possibly damaging Het
Dync1i1 T A 6: 5,913,443 F225L possibly damaging Het
Elp6 T A 9: 110,315,784 Y119* probably null Het
Enpep A T 3: 129,331,880 M201K probably benign Het
Fam161a A T 11: 23,020,661 R280W probably damaging Het
Fam98a T C 17: 75,541,335 N128S possibly damaging Het
Fpgt A T 3: 155,087,297 D364E probably benign Het
G3bp1 T A 11: 55,499,613 M448K probably damaging Het
Gadd45b T C 10: 80,930,450 M16T probably benign Het
Gdi2 A T 13: 3,564,869 I383F probably benign Het
Gm9268 C T 7: 43,024,075 P193S possibly damaging Het
Gm9833 T C 3: 10,088,731 S187P probably benign Het
H2-Bl T C 17: 36,081,101 T27A possibly damaging Het
Igtp T G 11: 58,206,200 L66V probably damaging Het
Kcne4 G A 1: 78,817,906 M90I probably benign Het
Lmo7 T A 14: 101,898,687 M732K probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mast4 T G 13: 102,781,245 S552R probably damaging Het
Mff A T 1: 82,729,286 M11L probably benign Het
Mterf2 T C 10: 85,120,463 E99G probably damaging Het
Myom2 T A 8: 15,099,210 N560K probably damaging Het
Nab2 A G 10: 127,664,711 S171P probably damaging Het
Nhlrc3 T C 3: 53,461,769 N83S possibly damaging Het
Nod2 A T 8: 88,664,405 I447F probably damaging Het
Npat T A 9: 53,563,156 D749E possibly damaging Het
Nxph4 A G 10: 127,526,762 S87P probably benign Het
Olfr1392 T A 11: 49,294,075 Y251* probably null Het
Olfr1497 T A 19: 13,794,850 T254S probably damaging Het
Olfr641 G T 7: 104,040,066 R90L possibly damaging Het
Olfr74 G A 2: 87,974,182 T161M possibly damaging Het
Olfr782 T A 10: 129,351,120 S186T probably damaging Het
Pcdha3 G A 18: 36,946,300 V32I probably benign Het
Pcdhgc3 A T 18: 37,806,638 T31S probably benign Het
Phldb3 A G 7: 24,623,872 R391G probably damaging Het
Piezo1 A G 8: 122,501,865 V257A Het
Pip5k1b T A 19: 24,439,078 Q15L probably benign Het
Plxnc1 T C 10: 94,813,231 N1229D probably benign Het
Ptpn12 A G 5: 21,019,214 V127A probably benign Het
Ptprr T A 10: 116,273,819 V655D probably benign Het
Rbbp8 A G 18: 11,705,831 T190A probably benign Het
Rnf17 T A 14: 56,482,122 V943E probably damaging Het
Rnpc3 C T 3: 113,611,264 G414D probably damaging Het
Robo4 T A 9: 37,404,862 N387K probably damaging Het
Sall4 G A 2: 168,755,861 T353M probably damaging Het
Serpinb13 T C 1: 106,982,267 I38T probably damaging Het
Sgsm1 A T 5: 113,274,273 I218N unknown Het
Sntg2 T A 12: 30,243,344 probably null Het
Tldc1 G A 8: 119,771,357 A136V probably benign Het
Trhde T G 10: 114,408,693 I963L probably damaging Het
Trim43b T C 9: 89,085,566 Y339C probably damaging Het
Trp53 T A 11: 69,589,711 probably null Het
Tubg2 T C 11: 101,160,795 V282A probably benign Het
Ube2g1 C T 11: 72,663,117 probably benign Het
Usp34 C A 11: 23,487,203 A3341E Het
Vmn2r12 T A 5: 109,086,120 H742L probably damaging Het
Vmn2r24 T C 6: 123,815,583 V623A probably damaging Het
Vmn2r5 A T 3: 64,503,895 D417E probably damaging Het
Xirp2 A T 2: 67,511,774 D1453V probably damaging Het
Zfp2 T C 11: 50,900,215 S334G probably damaging Het
Other mutations in Taf1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Taf1c APN 8 119601328 missense possibly damaging 0.80
IGL01098:Taf1c APN 8 119602841 missense probably damaging 0.98
IGL01287:Taf1c APN 8 119601192 missense probably benign 0.01
IGL02339:Taf1c APN 8 119604280 missense probably damaging 1.00
IGL02642:Taf1c APN 8 119599057 missense probably benign
IGL02954:Taf1c APN 8 119600486 missense probably damaging 1.00
R0026:Taf1c UTSW 8 119604236 splice site probably null
R0031:Taf1c UTSW 8 119599090 missense probably benign 0.00
R0087:Taf1c UTSW 8 119600987 missense probably damaging 1.00
R0197:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0701:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R0883:Taf1c UTSW 8 119599983 missense probably damaging 0.98
R2200:Taf1c UTSW 8 119598678 missense probably benign
R3726:Taf1c UTSW 8 119603070 missense probably damaging 1.00
R3765:Taf1c UTSW 8 119600485 nonsense probably null
R3916:Taf1c UTSW 8 119600505 missense probably damaging 1.00
R4368:Taf1c UTSW 8 119599316 missense possibly damaging 0.60
R4470:Taf1c UTSW 8 119599622 missense probably benign
R4501:Taf1c UTSW 8 119599429 missense probably damaging 1.00
R4661:Taf1c UTSW 8 119598850 missense probably damaging 0.99
R4741:Taf1c UTSW 8 119603395 unclassified probably benign
R4938:Taf1c UTSW 8 119598798 missense probably benign 0.26
R5481:Taf1c UTSW 8 119599240 missense probably damaging 1.00
R6335:Taf1c UTSW 8 119601779 missense probably damaging 1.00
R6517:Taf1c UTSW 8 119604247 missense possibly damaging 0.59
R7083:Taf1c UTSW 8 119600668 missense probably damaging 1.00
R7351:Taf1c UTSW 8 119599000 missense probably damaging 0.97
R8056:Taf1c UTSW 8 119603463 missense probably benign 0.13
R8170:Taf1c UTSW 8 119602826 splice site probably null
R8279:Taf1c UTSW 8 119599011 missense probably benign
R8382:Taf1c UTSW 8 119603050 missense probably damaging 1.00
R8492:Taf1c UTSW 8 119598717 missense probably benign 0.13
Z1177:Taf1c UTSW 8 119598827 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCTCACGTTTCCATGG -3'
(R):5'- GTAGCCAAGACCTCTCTACCTC -3'

Sequencing Primer
(F):5'- ACGTTTCCATGGGCACACTG -3'
(R):5'- TCCCAGGAGTTGACACAGG -3'
Posted On 2022-04-18