Incidental Mutation 'R9376:Dnah7a'
ID 709596
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7, LOC381341, Dnahc7a
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.128) question?
Stock # R9376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 53436165-53745943 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 53568058 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000094964
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,893,438 (GRCm39) L1296H probably damaging Het
Abcb4 A T 5: 9,008,988 (GRCm39) D1215V probably damaging Het
Ache A C 5: 137,289,025 (GRCm39) I244L probably benign Het
Ankrd13d A T 19: 4,332,250 (GRCm39) V58D probably damaging Het
Ano3 A G 2: 110,496,782 (GRCm39) L789S probably damaging Het
Atp2a3 T C 11: 72,863,290 (GRCm39) V129A probably damaging Het
Cldn11 T C 3: 31,217,410 (GRCm39) S193P possibly damaging Het
Clpb A T 7: 101,360,625 (GRCm39) R218S probably benign Het
Cntln A G 4: 84,875,258 (GRCm39) S231G probably benign Het
Cntn4 T C 6: 106,639,591 (GRCm39) Y574H probably damaging Het
Col6a3 C T 1: 90,709,523 (GRCm39) R2498H unknown Het
Ctdnep1 T C 11: 69,875,594 (GRCm39) V108A probably damaging Het
Cyp2c67 A T 19: 39,627,178 (GRCm39) N217K probably damaging Het
Dao T A 5: 114,147,901 (GRCm39) M1K probably null Het
Dchs1 A G 7: 105,414,981 (GRCm39) probably null Het
Dennd4a A T 9: 64,819,974 (GRCm39) I1809L probably benign Het
Epn1 A T 7: 5,086,720 (GRCm39) probably benign Het
Erich1 A G 8: 14,080,719 (GRCm39) S267P probably damaging Het
Gm17732 G T 18: 62,795,936 (GRCm39) V41L probably damaging Het
Gpaa1 C A 15: 76,218,826 (GRCm39) T556K possibly damaging Het
Gpr65 T A 12: 98,241,523 (GRCm39) S59T probably damaging Het
Hydin T C 8: 111,124,695 (GRCm39) V568A possibly damaging Het
Ifi205 T C 1: 173,854,221 (GRCm39) D144G probably benign Het
Itga1 T C 13: 115,107,112 (GRCm39) H993R probably benign Het
Itgax T C 7: 127,747,935 (GRCm39) L1075P possibly damaging Het
Itpr1 T A 6: 108,326,638 (GRCm39) V120E probably damaging Het
Kdm3b T C 18: 34,970,718 (GRCm39) S1762P probably damaging Het
Krt80 T A 15: 101,247,978 (GRCm39) T221S unknown Het
Lama2 T C 10: 26,994,620 (GRCm39) D1763G probably benign Het
Lrp5 T C 19: 3,670,286 (GRCm39) D606G probably benign Het
Map6d1 T C 16: 20,059,933 (GRCm39) D44G probably benign Het
Mtmr11 T A 3: 96,072,372 (GRCm39) I282K probably benign Het
Nalcn G A 14: 123,515,713 (GRCm39) T1696M possibly damaging Het
Nup214 T C 2: 31,924,244 (GRCm39) V1591A probably benign Het
Oas1f C A 5: 120,986,243 (GRCm39) Y65* probably null Het
Or1x6 T A 11: 50,939,662 (GRCm39) C243S probably damaging Het
Or2t43 T A 11: 58,457,683 (GRCm39) T163S possibly damaging Het
Or2t46 T C 11: 58,472,636 (GRCm39) V322A probably benign Het
Or51f1e A T 7: 102,746,971 (GRCm39) T8S probably benign Het
Or5p58 A T 7: 107,694,471 (GRCm39) I102K possibly damaging Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Pigyl A G 9: 22,069,324 (GRCm39) I12V probably benign Het
Pno1 A T 11: 17,158,791 (GRCm39) D202E probably benign Het
Ppp5c A T 7: 16,743,849 (GRCm39) M195K probably damaging Het
Prrc2a A T 17: 35,369,598 (GRCm39) F1905Y possibly damaging Het
Ptpn11 C A 5: 121,282,681 (GRCm39) D435Y probably damaging Het
Rbm33 A G 5: 28,544,164 (GRCm39) Y140C probably damaging Het
Runx1t1 A G 4: 13,865,225 (GRCm39) E339G possibly damaging Het
Scube3 G T 17: 28,383,670 (GRCm39) K480N possibly damaging Het
Sephs1 T A 2: 4,910,469 (GRCm39) M313K probably benign Het
Tcaim T C 9: 122,655,995 (GRCm39) W304R probably damaging Het
Terf2ip C T 8: 112,738,514 (GRCm39) T134I probably damaging Het
Terf2ip A G 8: 112,744,528 (GRCm39) T282A probably benign Het
Tnfrsf18 G T 4: 156,112,448 (GRCm39) A102S probably benign Het
Trim10 A T 17: 37,184,168 (GRCm39) I254F probably benign Het
Triqk A G 4: 12,962,987 (GRCm39) T9A probably benign Het
Tshz2 G A 2: 169,726,013 (GRCm39) S203N probably benign Het
Zc3h13 G A 14: 75,561,128 (GRCm39) V573I unknown Het
Zfhx4 A G 3: 5,306,833 (GRCm39) K20E probably damaging Het
Zfhx4 A G 3: 5,465,395 (GRCm39) D1876G probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53,458,843 (GRCm39) missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53,540,701 (GRCm39) missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53,496,905 (GRCm39) missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01322:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01357:Dnah7a APN 1 53,701,540 (GRCm39) missense probably benign
IGL01417:Dnah7a APN 1 53,623,759 (GRCm39) missense probably benign 0.01
IGL01508:Dnah7a APN 1 53,666,231 (GRCm39) missense probably benign 0.00
IGL01511:Dnah7a APN 1 53,458,754 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53,557,941 (GRCm39) missense probably benign
IGL01575:Dnah7a APN 1 53,466,979 (GRCm39) splice site probably benign
IGL01667:Dnah7a APN 1 53,586,451 (GRCm39) missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53,462,429 (GRCm39) missense probably benign 0.23
IGL01824:Dnah7a APN 1 53,543,429 (GRCm39) missense probably benign
IGL01829:Dnah7a APN 1 53,657,227 (GRCm39) missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53,623,608 (GRCm39) splice site probably benign
IGL01861:Dnah7a APN 1 53,679,508 (GRCm39) missense probably benign 0.01
IGL01984:Dnah7a APN 1 53,741,174 (GRCm39) splice site probably null
IGL02056:Dnah7a APN 1 53,543,501 (GRCm39) missense probably benign 0.17
IGL02069:Dnah7a APN 1 53,601,053 (GRCm39) splice site probably benign
IGL02072:Dnah7a APN 1 53,644,986 (GRCm39) missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53,450,739 (GRCm39) missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53,534,876 (GRCm39) missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53,476,672 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53,662,632 (GRCm39) missense probably benign 0.01
IGL02151:Dnah7a APN 1 53,512,023 (GRCm39) missense probably benign 0.08
IGL02156:Dnah7a APN 1 53,458,882 (GRCm39) missense probably benign 0.27
IGL02270:Dnah7a APN 1 53,512,052 (GRCm39) missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53,682,669 (GRCm39) missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53,564,096 (GRCm39) critical splice donor site probably null
IGL02370:Dnah7a APN 1 53,674,556 (GRCm39) missense probably benign 0.00
IGL02420:Dnah7a APN 1 53,725,702 (GRCm39) missense probably benign
IGL02458:Dnah7a APN 1 53,657,487 (GRCm39) nonsense probably null
IGL02489:Dnah7a APN 1 53,686,481 (GRCm39) missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53,657,205 (GRCm39) missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53,472,074 (GRCm39) missense probably benign 0.00
IGL02646:Dnah7a APN 1 53,564,194 (GRCm39) missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53,543,183 (GRCm39) missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53,483,631 (GRCm39) missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53,512,118 (GRCm39) splice site probably benign
IGL02874:Dnah7a APN 1 53,644,973 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53,561,519 (GRCm39) missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53,616,487 (GRCm39) missense probably benign 0.27
IGL02926:Dnah7a APN 1 53,535,109 (GRCm39) missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53,472,163 (GRCm39) missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53,644,983 (GRCm39) missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53,458,766 (GRCm39) missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53,725,773 (GRCm39) splice site probably benign
IGL03214:Dnah7a APN 1 53,561,368 (GRCm39) critical splice donor site probably null
IGL03242:Dnah7a APN 1 53,659,882 (GRCm39) missense probably benign 0.02
IGL03251:Dnah7a APN 1 53,686,433 (GRCm39) missense probably benign
IGL03265:Dnah7a APN 1 53,568,007 (GRCm39) missense probably benign
IGL03277:Dnah7a APN 1 53,669,481 (GRCm39) missense probably benign 0.00
IGL03278:Dnah7a APN 1 53,536,124 (GRCm39) missense probably benign 0.07
IGL03356:Dnah7a APN 1 53,543,093 (GRCm39) missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53,570,362 (GRCm39) missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53,496,033 (GRCm39) splice site probably null
R0051:Dnah7a UTSW 1 53,560,245 (GRCm39) splice site probably benign
R0082:Dnah7a UTSW 1 53,557,867 (GRCm39) missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53,507,843 (GRCm39) missense probably benign 0.03
R0122:Dnah7a UTSW 1 53,436,301 (GRCm39) missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53,540,685 (GRCm39) missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53,543,305 (GRCm39) missense probably benign 0.00
R0309:Dnah7a UTSW 1 53,444,849 (GRCm39) missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53,472,213 (GRCm39) missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53,543,357 (GRCm39) missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53,644,978 (GRCm39) missense probably benign 0.00
R0511:Dnah7a UTSW 1 53,536,285 (GRCm39) missense probably benign
R0576:Dnah7a UTSW 1 53,675,246 (GRCm39) missense probably benign 0.12
R0592:Dnah7a UTSW 1 53,495,771 (GRCm39) missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53,536,264 (GRCm39) missense probably benign 0.18
R0689:Dnah7a UTSW 1 53,659,840 (GRCm39) nonsense probably null
R0735:Dnah7a UTSW 1 53,583,670 (GRCm39) missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53,604,855 (GRCm39) missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53,543,238 (GRCm39) missense probably benign 0.07
R0842:Dnah7a UTSW 1 53,540,833 (GRCm39) missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53,467,019 (GRCm39) missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53,507,828 (GRCm39) missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53,686,395 (GRCm39) splice site probably benign
R1421:Dnah7a UTSW 1 53,580,032 (GRCm39) splice site probably benign
R1445:Dnah7a UTSW 1 53,567,956 (GRCm39) missense probably benign 0.02
R1473:Dnah7a UTSW 1 53,535,173 (GRCm39) missense probably benign 0.00
R1538:Dnah7a UTSW 1 53,535,148 (GRCm39) missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53,495,843 (GRCm39) missense probably benign 0.39
R1754:Dnah7a UTSW 1 53,601,059 (GRCm39) critical splice donor site probably null
R1754:Dnah7a UTSW 1 53,543,344 (GRCm39) missense probably benign 0.18
R1773:Dnah7a UTSW 1 53,472,046 (GRCm39) splice site probably null
R1779:Dnah7a UTSW 1 53,616,382 (GRCm39) missense probably benign
R1816:Dnah7a UTSW 1 53,670,901 (GRCm39) splice site probably benign
R1817:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1818:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1819:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1873:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1875:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1884:Dnah7a UTSW 1 53,580,159 (GRCm39) missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53,670,721 (GRCm39) missense probably benign
R1959:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1960:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1985:Dnah7a UTSW 1 53,543,093 (GRCm39) missense probably benign 0.01
R1992:Dnah7a UTSW 1 53,621,835 (GRCm39) missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53,621,741 (GRCm39) missense probably benign 0.00
R2074:Dnah7a UTSW 1 53,496,855 (GRCm39) missense probably benign 0.45
R2076:Dnah7a UTSW 1 53,542,968 (GRCm39) missense probably benign 0.01
R2124:Dnah7a UTSW 1 53,536,101 (GRCm39) missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53,645,034 (GRCm39) missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53,518,932 (GRCm39) missense probably benign 0.21
R2220:Dnah7a UTSW 1 53,560,333 (GRCm39) missense probably benign
R2355:Dnah7a UTSW 1 53,621,661 (GRCm39) missense probably benign 0.00
R2495:Dnah7a UTSW 1 53,645,040 (GRCm39) missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53,467,031 (GRCm39) missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53,466,983 (GRCm39) critical splice donor site probably null
R2993:Dnah7a UTSW 1 53,542,713 (GRCm39) missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53,657,275 (GRCm39) missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53,483,675 (GRCm39) missense probably benign
R3723:Dnah7a UTSW 1 53,486,505 (GRCm39) missense probably benign 0.04
R3847:Dnah7a UTSW 1 53,540,815 (GRCm39) missense probably benign 0.01
R4002:Dnah7a UTSW 1 53,670,840 (GRCm39) missense probably benign
R4009:Dnah7a UTSW 1 53,564,164 (GRCm39) missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53,464,376 (GRCm39) missense probably benign
R4193:Dnah7a UTSW 1 53,486,493 (GRCm39) missense probably benign 0.00
R4236:Dnah7a UTSW 1 53,486,524 (GRCm39) missense probably benign 0.00
R4399:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53,483,685 (GRCm39) missense probably benign 0.01
R4494:Dnah7a UTSW 1 53,488,197 (GRCm39) missense probably benign 0.01
R4569:Dnah7a UTSW 1 53,450,818 (GRCm39) missense probably benign 0.01
R4609:Dnah7a UTSW 1 53,495,816 (GRCm39) missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53,467,110 (GRCm39) missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53,486,476 (GRCm39) critical splice donor site probably null
R4781:Dnah7a UTSW 1 53,464,367 (GRCm39) missense probably benign 0.28
R4854:Dnah7a UTSW 1 53,745,888 (GRCm39) utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53,542,737 (GRCm39) missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5000:Dnah7a UTSW 1 53,606,201 (GRCm39) missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53,686,407 (GRCm39) nonsense probably null
R5026:Dnah7a UTSW 1 53,701,657 (GRCm39) missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53,536,255 (GRCm39) missense probably benign 0.01
R5119:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5151:Dnah7a UTSW 1 53,659,929 (GRCm39) missense probably benign 0.00
R5155:Dnah7a UTSW 1 53,682,654 (GRCm39) missense probably benign 0.01
R5180:Dnah7a UTSW 1 53,462,446 (GRCm39) missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53,476,768 (GRCm39) critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53,486,690 (GRCm39) splice site probably null
R5267:Dnah7a UTSW 1 53,518,851 (GRCm39) missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53,542,805 (GRCm39) missense probably benign 0.00
R5358:Dnah7a UTSW 1 53,586,331 (GRCm39) missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53,670,812 (GRCm39) missense probably benign 0.01
R5412:Dnah7a UTSW 1 53,674,503 (GRCm39) missense probably benign
R5496:Dnah7a UTSW 1 53,496,927 (GRCm39) missense probably benign
R5531:Dnah7a UTSW 1 53,458,907 (GRCm39) missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53,464,412 (GRCm39) missense probably benign
R5543:Dnah7a UTSW 1 53,543,228 (GRCm39) missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53,573,611 (GRCm39) missense probably benign 0.00
R5609:Dnah7a UTSW 1 53,621,753 (GRCm39) missense probably benign 0.03
R5643:Dnah7a UTSW 1 53,444,866 (GRCm39) missense probably benign
R5644:Dnah7a UTSW 1 53,580,138 (GRCm39) missense probably benign 0.33
R5689:Dnah7a UTSW 1 53,444,857 (GRCm39) missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53,452,937 (GRCm39) missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53,522,478 (GRCm39) missense probably benign 0.03
R5893:Dnah7a UTSW 1 53,496,944 (GRCm39) missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53,598,467 (GRCm39) missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53,659,829 (GRCm39) missense probably benign 0.00
R6102:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R6108:Dnah7a UTSW 1 53,496,004 (GRCm39) missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53,458,814 (GRCm39) missense probably benign 0.05
R6168:Dnah7a UTSW 1 53,450,727 (GRCm39) missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53,472,181 (GRCm39) missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53,458,795 (GRCm39) missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53,542,760 (GRCm39) missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53,580,273 (GRCm39) missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53,436,349 (GRCm39) missense probably benign 0.02
R6530:Dnah7a UTSW 1 53,542,856 (GRCm39) missense probably benign 0.04
R6574:Dnah7a UTSW 1 53,495,693 (GRCm39) critical splice donor site probably null
R6608:Dnah7a UTSW 1 53,564,277 (GRCm39) missense probably benign
R6625:Dnah7a UTSW 1 53,604,916 (GRCm39) missense probably benign 0.05
R6661:Dnah7a UTSW 1 53,662,609 (GRCm39) missense probably benign 0.00
R6681:Dnah7a UTSW 1 53,560,385 (GRCm39) critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53,675,221 (GRCm39) missense probably benign 0.01
R6774:Dnah7a UTSW 1 53,737,810 (GRCm39) missense probably benign
R6823:Dnah7a UTSW 1 53,495,863 (GRCm39) missense probably benign
R6900:Dnah7a UTSW 1 53,701,510 (GRCm39) missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53,670,836 (GRCm39) missense probably benign 0.09
R6956:Dnah7a UTSW 1 53,616,446 (GRCm39) missense probably benign 0.02
R6978:Dnah7a UTSW 1 53,701,526 (GRCm39) missense probably null
R6988:Dnah7a UTSW 1 53,621,784 (GRCm39) missense possibly damaging 0.62
R7026:Dnah7a UTSW 1 53,543,448 (GRCm39) missense probably benign
R7027:Dnah7a UTSW 1 53,670,665 (GRCm39) missense probably benign 0.01
R7033:Dnah7a UTSW 1 53,518,820 (GRCm39) missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53,458,912 (GRCm39) missense probably benign 0.00
R7096:Dnah7a UTSW 1 53,522,599 (GRCm39) missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53,452,927 (GRCm39) nonsense probably null
R7144:Dnah7a UTSW 1 53,737,867 (GRCm39) splice site probably null
R7167:Dnah7a UTSW 1 53,542,935 (GRCm39) missense probably benign 0.00
R7182:Dnah7a UTSW 1 53,659,620 (GRCm39) splice site probably null
R7196:Dnah7a UTSW 1 53,724,000 (GRCm39) missense probably benign 0.00
R7206:Dnah7a UTSW 1 53,737,792 (GRCm39) nonsense probably null
R7215:Dnah7a UTSW 1 53,657,509 (GRCm39) missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53,436,420 (GRCm39) missense probably benign 0.00
R7264:Dnah7a UTSW 1 53,557,973 (GRCm39) missense probably benign
R7282:Dnah7a UTSW 1 53,724,059 (GRCm39) critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53,536,297 (GRCm39) missense probably benign
R7392:Dnah7a UTSW 1 53,540,820 (GRCm39) missense probably benign 0.00
R7454:Dnah7a UTSW 1 53,557,923 (GRCm39) missense probably benign
R7471:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53,702,996 (GRCm39) missense probably benign 0.00
R7554:Dnah7a UTSW 1 53,567,857 (GRCm39) missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53,586,456 (GRCm39) missense probably benign 0.00
R7721:Dnah7a UTSW 1 53,670,842 (GRCm39) missense probably benign
R7813:Dnah7a UTSW 1 53,657,245 (GRCm39) missense probably benign
R7839:Dnah7a UTSW 1 53,606,334 (GRCm39) missense probably benign 0.08
R7959:Dnah7a UTSW 1 53,682,621 (GRCm39) missense probably benign 0.00
R7984:Dnah7a UTSW 1 53,543,377 (GRCm39) missense probably benign 0.01
R7985:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53,543,049 (GRCm39) missense probably benign
R8140:Dnah7a UTSW 1 53,540,748 (GRCm39) missense probably benign 0.02
R8184:Dnah7a UTSW 1 53,666,194 (GRCm39) missense probably benign 0.03
R8339:Dnah7a UTSW 1 53,724,178 (GRCm39) missense probably benign
R8352:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8423:Dnah7a UTSW 1 53,512,063 (GRCm39) missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53,512,112 (GRCm39) missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53,657,195 (GRCm39) missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8458:Dnah7a UTSW 1 53,657,142 (GRCm39) missense probably benign 0.01
R8493:Dnah7a UTSW 1 53,512,067 (GRCm39) missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53,657,139 (GRCm39) missense probably benign 0.01
R8502:Dnah7a UTSW 1 53,679,520 (GRCm39) missense probably benign 0.39
R8692:Dnah7a UTSW 1 53,472,175 (GRCm39) missense probably benign 0.00
R8700:Dnah7a UTSW 1 53,535,088 (GRCm39) missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53,674,476 (GRCm39) missense probably benign
R8856:Dnah7a UTSW 1 53,462,422 (GRCm39) missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53,682,682 (GRCm39) missense probably benign 0.10
R8967:Dnah7a UTSW 1 53,682,594 (GRCm39) splice site probably benign
R8982:Dnah7a UTSW 1 53,570,301 (GRCm39) missense probably benign
R8984:Dnah7a UTSW 1 53,674,436 (GRCm39) nonsense probably null
R8993:Dnah7a UTSW 1 53,543,262 (GRCm39) missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53,701,501 (GRCm39) missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53,512,116 (GRCm39) critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53,560,297 (GRCm39) missense probably benign 0.00
R9077:Dnah7a UTSW 1 53,741,218 (GRCm39) missense unknown
R9167:Dnah7a UTSW 1 53,657,370 (GRCm39) missense probably benign 0.00
R9206:Dnah7a UTSW 1 53,540,757 (GRCm39) missense probably benign 0.11
R9226:Dnah7a UTSW 1 53,560,326 (GRCm39) missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53,621,671 (GRCm39) missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53,674,505 (GRCm39) missense probably benign
R9350:Dnah7a UTSW 1 53,436,307 (GRCm39) missense probably benign 0.19
R9369:Dnah7a UTSW 1 53,564,222 (GRCm39) missense possibly damaging 0.72
R9369:Dnah7a UTSW 1 53,543,421 (GRCm39) missense probably benign
R9372:Dnah7a UTSW 1 53,543,474 (GRCm39) missense probably benign
R9378:Dnah7a UTSW 1 53,621,776 (GRCm39) missense probably benign 0.32
R9401:Dnah7a UTSW 1 53,568,026 (GRCm39) missense probably benign 0.01
R9431:Dnah7a UTSW 1 53,450,812 (GRCm39) missense possibly damaging 0.90
R9529:Dnah7a UTSW 1 53,561,495 (GRCm39) missense probably damaging 1.00
R9701:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
R9712:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R9799:Dnah7a UTSW 1 53,557,968 (GRCm39) missense probably benign 0.00
R9802:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
X0027:Dnah7a UTSW 1 53,512,089 (GRCm39) missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53,507,802 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,522,622 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53,598,261 (GRCm39) missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53,450,815 (GRCm39) missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53,682,616 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCCCTTCTCAGGAAATGGCAC -3'
(R):5'- CTTGAATTTGTGCTGCATTGCATC -3'

Sequencing Primer
(F):5'- GGCACTATAAACACCTTTGAGG -3'
(R):5'- GCTGCATTGCATCACTTTAAAG -3'
Posted On 2022-04-18