Incidental Mutation 'R9376:Ano3'
ID 709601
Institutional Source Beutler Lab
Gene Symbol Ano3
Ensembl Gene ENSMUSG00000074968
Gene Name anoctamin 3
Synonyms Tmem16c, B230324K02Rik
Accession Numbers

Genbank: NM_001081556, NM_001128103; MGI: 3613666

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 110655201-110950923 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 110666437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 789 (L789S)
Ref Sequence ENSEMBL: ENSMUSP00000097219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099623]
AlphaFold A2AHL1
Predicted Effect probably damaging
Transcript: ENSMUST00000099623
AA Change: L789S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097219
Gene: ENSMUSG00000074968
AA Change: L789S

DomainStartEndE-ValueType
Pfam:Anoct_dimer 156 381 2.9e-70 PFAM
Pfam:Anoctamin 384 950 4.4e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the TMEM16 family of predicted membrane proteins, that are also known as anoctamins. While little is known about the function of this gene, mutations in this gene have been associated with some cases of autosomal dominant craniocervical dystonia. Cells from individuals with a mutation in this gene exhibited abnormalities in endoplasmic reticulum-dependent calcium signaling. Studies in rat show that the rat ortholog of this protein interacts with, and modulates the activity of a sodium-activated potassium channel. Deletion of this gene caused increased pain sensitivity in the rat model system. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,215 L1296H probably damaging Het
Abcb4 A T 5: 8,958,988 D1215V probably damaging Het
Ache A C 5: 137,290,763 I244L probably benign Het
Ankrd13d A T 19: 4,282,222 V58D probably damaging Het
Atp2a3 T C 11: 72,972,464 V129A probably damaging Het
Cldn11 T C 3: 31,163,261 S193P possibly damaging Het
Clpb A T 7: 101,711,418 R218S probably benign Het
Cntln A G 4: 84,957,021 S231G probably benign Het
Cntn4 T C 6: 106,662,630 Y574H probably damaging Het
Col6a3 C T 1: 90,781,801 R2498H unknown Het
Ctdnep1 T C 11: 69,984,768 V108A probably damaging Het
Cyp2c67 A T 19: 39,638,734 N217K probably damaging Het
Dao T A 5: 114,009,840 M1K probably null Het
Dchs1 A G 7: 105,765,774 probably null Het
Dennd4a A T 9: 64,912,692 I1809L probably benign Het
Dnah7a T A 1: 53,528,899 probably null Het
Epn1 A T 7: 5,083,721 probably benign Het
Erich1 A G 8: 14,030,719 S267P probably damaging Het
Gm17732 G T 18: 62,662,865 V41L probably damaging Het
Gpaa1 C A 15: 76,334,626 T556K possibly damaging Het
Gpr65 T A 12: 98,275,264 S59T probably damaging Het
Hydin T C 8: 110,398,063 V568A possibly damaging Het
Ifi205 T C 1: 174,026,655 D144G probably benign Het
Itga1 T C 13: 114,970,576 H993R probably benign Het
Itgax T C 7: 128,148,763 L1075P possibly damaging Het
Itpr1 T A 6: 108,349,677 V120E probably damaging Het
Kdm3b T C 18: 34,837,665 S1762P probably damaging Het
Krt80 T A 15: 101,350,097 T221S unknown Het
Lama2 T C 10: 27,118,624 D1763G probably benign Het
Lrp5 T C 19: 3,620,286 D606G probably benign Het
Map6d1 T C 16: 20,241,183 D44G probably benign Het
Mtmr11 T A 3: 96,165,055 I282K probably benign Het
Nalcn G A 14: 123,278,301 T1696M possibly damaging Het
Nup214 T C 2: 32,034,232 V1591A probably benign Het
Oas1f C A 5: 120,848,180 Y65* probably null Het
Olfr1375 T A 11: 51,048,835 C243S probably damaging Het
Olfr224 T A 11: 58,566,857 T163S possibly damaging Het
Olfr325 T C 11: 58,581,810 V322A probably benign Het
Olfr482 A T 7: 108,095,264 I102K possibly damaging Het
Olfr585 A T 7: 103,097,764 T8S probably benign Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pigyl A G 9: 22,158,028 I12V probably benign Het
Pno1 A T 11: 17,208,791 D202E probably benign Het
Ppp5c A T 7: 17,009,924 M195K probably damaging Het
Prrc2a A T 17: 35,150,622 F1905Y possibly damaging Het
Ptpn11 C A 5: 121,144,618 D435Y probably damaging Het
Rbm33 A G 5: 28,339,166 Y140C probably damaging Het
Runx1t1 A G 4: 13,865,225 E339G possibly damaging Het
Scube3 G T 17: 28,164,696 K480N possibly damaging Het
Sephs1 T A 2: 4,905,658 M313K probably benign Het
Tcaim T C 9: 122,826,930 W304R probably damaging Het
Terf2ip C T 8: 112,011,882 T134I probably damaging Het
Terf2ip A G 8: 112,017,896 T282A probably benign Het
Tnfrsf18 G T 4: 156,027,991 A102S probably benign Het
Trim10 A T 17: 36,873,276 I254F probably benign Het
Triqk A G 4: 12,962,987 T9A probably benign Het
Tshz2 G A 2: 169,884,093 S203N probably benign Het
Zc3h13 G A 14: 75,323,688 V573I unknown Het
Zfhx4 A G 3: 5,241,773 K20E probably damaging Het
Zfhx4 A G 3: 5,400,335 D1876G probably benign Het
Other mutations in Ano3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ano3 APN 2 110771050 splice site probably benign
IGL01066:Ano3 APN 2 110661445 missense probably null 0.00
IGL01696:Ano3 APN 2 110667737 missense probably damaging 1.00
IGL01729:Ano3 APN 2 110781394 splice site probably null
IGL01785:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01786:Ano3 APN 2 110682715 missense probably damaging 1.00
IGL01992:Ano3 APN 2 110658219 missense probably damaging 1.00
IGL02098:Ano3 APN 2 110666441 nonsense probably null
IGL02333:Ano3 APN 2 110697199 splice site probably benign
IGL02346:Ano3 APN 2 110770926 splice site probably benign
IGL02352:Ano3 APN 2 110884943 nonsense probably null
IGL02359:Ano3 APN 2 110884943 nonsense probably null
IGL02544:Ano3 APN 2 110658249 missense possibly damaging 0.79
IGL02750:Ano3 APN 2 110665984 splice site probably benign
IGL02861:Ano3 APN 2 110738812 missense probably damaging 1.00
IGL02948:Ano3 APN 2 110697018 splice site probably benign
IGL03327:Ano3 APN 2 110697178 missense possibly damaging 0.62
3-1:Ano3 UTSW 2 110697124 missense probably damaging 1.00
IGL02988:Ano3 UTSW 2 110775010 missense probably damaging 1.00
IGL03147:Ano3 UTSW 2 110697418 missense probably damaging 1.00
R0349:Ano3 UTSW 2 110661487 missense probably damaging 1.00
R0426:Ano3 UTSW 2 110661174 missense probably damaging 1.00
R0523:Ano3 UTSW 2 110884855 missense probably benign 0.13
R0557:Ano3 UTSW 2 110862952 splice site probably null
R0611:Ano3 UTSW 2 110885001 missense possibly damaging 0.93
R0891:Ano3 UTSW 2 110697976 missense probably benign 0.03
R1459:Ano3 UTSW 2 110880829 missense probably benign 0.00
R1460:Ano3 UTSW 2 110682758 missense probably damaging 0.97
R1773:Ano3 UTSW 2 110761455 missense probably damaging 1.00
R1874:Ano3 UTSW 2 110884872 missense probably benign 0.00
R1919:Ano3 UTSW 2 110885007 missense probably benign
R2185:Ano3 UTSW 2 110775045 missense probably benign 0.01
R2280:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2281:Ano3 UTSW 2 110682759 missense probably benign 0.22
R2348:Ano3 UTSW 2 110783743 missense possibly damaging 0.82
R2425:Ano3 UTSW 2 110862843 missense probably benign
R2697:Ano3 UTSW 2 110794960 missense possibly damaging 0.79
R3888:Ano3 UTSW 2 110885000 missense probably damaging 0.99
R3923:Ano3 UTSW 2 110770959 missense probably damaging 1.00
R4352:Ano3 UTSW 2 110745894 missense possibly damaging 0.74
R4447:Ano3 UTSW 2 110761578 splice site probably null
R4790:Ano3 UTSW 2 110884919 missense probably benign
R4832:Ano3 UTSW 2 110667722 missense probably damaging 1.00
R4916:Ano3 UTSW 2 110771020 missense possibly damaging 0.74
R5113:Ano3 UTSW 2 110661480 missense possibly damaging 0.61
R5486:Ano3 UTSW 2 110745870 missense probably damaging 1.00
R5498:Ano3 UTSW 2 110697103 missense possibly damaging 0.68
R5589:Ano3 UTSW 2 110884995 missense probably damaging 0.99
R5627:Ano3 UTSW 2 110756953 missense possibly damaging 0.61
R5741:Ano3 UTSW 2 110658273 missense probably benign 0.11
R5767:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R5883:Ano3 UTSW 2 110880864 missense probably null 0.15
R5899:Ano3 UTSW 2 110862887 missense probably benign 0.39
R5916:Ano3 UTSW 2 110681836 missense probably benign 0.29
R6158:Ano3 UTSW 2 110665875 missense probably damaging 1.00
R6315:Ano3 UTSW 2 110697039 missense probably damaging 1.00
R6401:Ano3 UTSW 2 110775114 missense probably benign 0.01
R6481:Ano3 UTSW 2 110795027 missense probably benign 0.16
R6482:Ano3 UTSW 2 110697055 missense probably damaging 1.00
R6587:Ano3 UTSW 2 110797904 splice site probably null
R6811:Ano3 UTSW 2 110880867 missense probably benign 0.03
R7048:Ano3 UTSW 2 110682771 nonsense probably null
R7145:Ano3 UTSW 2 110862860 missense probably benign 0.31
R7207:Ano3 UTSW 2 110781423 missense probably damaging 0.96
R7215:Ano3 UTSW 2 110665932 missense probably damaging 1.00
R7366:Ano3 UTSW 2 110757067 missense probably damaging 1.00
R7371:Ano3 UTSW 2 110884849 critical splice donor site probably null
R7568:Ano3 UTSW 2 110950293 start gained probably benign
R7636:Ano3 UTSW 2 110682703 nonsense probably null
R7888:Ano3 UTSW 2 110666428 missense probably damaging 1.00
R7992:Ano3 UTSW 2 110775022 missense possibly damaging 0.77
R8024:Ano3 UTSW 2 110667783 missense probably damaging 0.99
R8074:Ano3 UTSW 2 110950232 start gained probably benign
R8111:Ano3 UTSW 2 110783713 missense possibly damaging 0.95
R8177:Ano3 UTSW 2 110666456 missense probably damaging 1.00
R8297:Ano3 UTSW 2 110661271 missense probably damaging 1.00
R8485:Ano3 UTSW 2 110667855 critical splice acceptor site probably null
R8509:Ano3 UTSW 2 110665835 missense possibly damaging 0.50
R8870:Ano3 UTSW 2 110783729 missense probably benign 0.12
R9071:Ano3 UTSW 2 110795073 critical splice acceptor site probably null
R9072:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9073:Ano3 UTSW 2 110745898 missense probably benign 0.06
R9315:Ano3 UTSW 2 110697942 missense probably damaging 0.97
RF012:Ano3 UTSW 2 110697523 missense possibly damaging 0.83
RF013:Ano3 UTSW 2 110697036 missense probably benign 0.30
X0058:Ano3 UTSW 2 110697418 missense probably damaging 1.00
Z1088:Ano3 UTSW 2 110745847 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGCAAGATGAAAGCTCTC -3'
(R):5'- TCATCCAGTGCTCCCAGTTG -3'

Sequencing Primer
(F):5'- GTATCAGATTGCCTAGTGAGTCACC -3'
(R):5'- CTCCCAGTTGGTGCAGTGAG -3'
Posted On 2022-04-18