Incidental Mutation 'R9376:Erich1'
ID 709627
Institutional Source Beutler Lab
Gene Symbol Erich1
Ensembl Gene ENSMUSG00000051978
Gene Name glutamate rich 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R9376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 14027561-14090301 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14030719 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 267 (S267P)
Ref Sequence ENSEMBL: ENSMUSP00000106436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110813] [ENSMUST00000211242]
AlphaFold E9PY43
Predicted Effect probably damaging
Transcript: ENSMUST00000110813
AA Change: S267P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106436
Gene: ENSMUSG00000051978
AA Change: S267P

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 188 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211242
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,215 L1296H probably damaging Het
Abcb4 A T 5: 8,958,988 D1215V probably damaging Het
Ache A C 5: 137,290,763 I244L probably benign Het
Ankrd13d A T 19: 4,282,222 V58D probably damaging Het
Ano3 A G 2: 110,666,437 L789S probably damaging Het
Atp2a3 T C 11: 72,972,464 V129A probably damaging Het
Cldn11 T C 3: 31,163,261 S193P possibly damaging Het
Clpb A T 7: 101,711,418 R218S probably benign Het
Cntln A G 4: 84,957,021 S231G probably benign Het
Cntn4 T C 6: 106,662,630 Y574H probably damaging Het
Col6a3 C T 1: 90,781,801 R2498H unknown Het
Ctdnep1 T C 11: 69,984,768 V108A probably damaging Het
Cyp2c67 A T 19: 39,638,734 N217K probably damaging Het
Dao T A 5: 114,009,840 M1K probably null Het
Dchs1 A G 7: 105,765,774 probably null Het
Dennd4a A T 9: 64,912,692 I1809L probably benign Het
Dnah7a T A 1: 53,528,899 probably null Het
Epn1 A T 7: 5,083,721 probably benign Het
Gm17732 G T 18: 62,662,865 V41L probably damaging Het
Gpaa1 C A 15: 76,334,626 T556K possibly damaging Het
Gpr65 T A 12: 98,275,264 S59T probably damaging Het
Hydin T C 8: 110,398,063 V568A possibly damaging Het
Ifi205 T C 1: 174,026,655 D144G probably benign Het
Itga1 T C 13: 114,970,576 H993R probably benign Het
Itgax T C 7: 128,148,763 L1075P possibly damaging Het
Itpr1 T A 6: 108,349,677 V120E probably damaging Het
Kdm3b T C 18: 34,837,665 S1762P probably damaging Het
Krt80 T A 15: 101,350,097 T221S unknown Het
Lama2 T C 10: 27,118,624 D1763G probably benign Het
Lrp5 T C 19: 3,620,286 D606G probably benign Het
Map6d1 T C 16: 20,241,183 D44G probably benign Het
Mtmr11 T A 3: 96,165,055 I282K probably benign Het
Nalcn G A 14: 123,278,301 T1696M possibly damaging Het
Nup214 T C 2: 32,034,232 V1591A probably benign Het
Oas1f C A 5: 120,848,180 Y65* probably null Het
Olfr1375 T A 11: 51,048,835 C243S probably damaging Het
Olfr224 T A 11: 58,566,857 T163S possibly damaging Het
Olfr325 T C 11: 58,581,810 V322A probably benign Het
Olfr482 A T 7: 108,095,264 I102K possibly damaging Het
Olfr585 A T 7: 103,097,764 T8S probably benign Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pigyl A G 9: 22,158,028 I12V probably benign Het
Pno1 A T 11: 17,208,791 D202E probably benign Het
Ppp5c A T 7: 17,009,924 M195K probably damaging Het
Prrc2a A T 17: 35,150,622 F1905Y possibly damaging Het
Ptpn11 C A 5: 121,144,618 D435Y probably damaging Het
Rbm33 A G 5: 28,339,166 Y140C probably damaging Het
Runx1t1 A G 4: 13,865,225 E339G possibly damaging Het
Scube3 G T 17: 28,164,696 K480N possibly damaging Het
Sephs1 T A 2: 4,905,658 M313K probably benign Het
Tcaim T C 9: 122,826,930 W304R probably damaging Het
Terf2ip C T 8: 112,011,882 T134I probably damaging Het
Terf2ip A G 8: 112,017,896 T282A probably benign Het
Tnfrsf18 G T 4: 156,027,991 A102S probably benign Het
Trim10 A T 17: 36,873,276 I254F probably benign Het
Triqk A G 4: 12,962,987 T9A probably benign Het
Tshz2 G A 2: 169,884,093 S203N probably benign Het
Zc3h13 G A 14: 75,323,688 V573I unknown Het
Zfhx4 A G 3: 5,241,773 K20E probably damaging Het
Zfhx4 A G 3: 5,400,335 D1876G probably benign Het
Other mutations in Erich1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Erich1 APN 8 14033770 splice site probably benign
IGL00927:Erich1 APN 8 14033518 missense probably damaging 1.00
IGL01448:Erich1 APN 8 14078853 missense possibly damaging 0.95
R1165:Erich1 UTSW 8 14090530 unclassified probably benign
R1541:Erich1 UTSW 8 14030688 missense probably damaging 0.97
R1699:Erich1 UTSW 8 14090259 missense possibly damaging 0.73
R2094:Erich1 UTSW 8 14090527 unclassified probably benign
R2153:Erich1 UTSW 8 14078773 missense probably benign 0.08
R3807:Erich1 UTSW 8 14033695 missense probably benign 0.11
R5787:Erich1 UTSW 8 14033776 splice site probably null
R6119:Erich1 UTSW 8 14033692 missense probably benign
R7034:Erich1 UTSW 8 14064330 missense probably benign 0.02
R7363:Erich1 UTSW 8 14033688 missense probably benign 0.05
R7687:Erich1 UTSW 8 14030691 missense probably damaging 0.99
R9087:Erich1 UTSW 8 14033623 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCTAGGTCTTATCGGAGGAAATTC -3'
(R):5'- TATGGCGGCACTTGGATGTC -3'

Sequencing Primer
(F):5'- TTCCTGAATAGACACTGCGG -3'
(R):5'- GGATGTCATGTTTCTTCCCAGAG -3'
Posted On 2022-04-18