Incidental Mutation 'R9376:Trim10'
ID 709651
Institutional Source Beutler Lab
Gene Symbol Trim10
Ensembl Gene ENSMUSG00000073400
Gene Name tripartite motif-containing 10
Synonyms Rnf9, Herf1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock # R9376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 36869574-36877833 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 36873276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 254 (I254F)
Ref Sequence ENSEMBL: ENSMUSP00000057928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060524]
AlphaFold Q9WUH5
Predicted Effect probably benign
Transcript: ENSMUST00000060524
AA Change: I254F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000057928
Gene: ENSMUSG00000073400
AA Change: I254F

DomainStartEndE-ValueType
RING 16 60 1.2e-7 SMART
BBOX 94 135 5.38e-10 SMART
coiled coil region 152 175 N/A INTRINSIC
low complexity region 187 207 N/A INTRINSIC
PRY 309 361 1.04e-25 SMART
SPRY 362 485 1.51e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,215 L1296H probably damaging Het
Abcb4 A T 5: 8,958,988 D1215V probably damaging Het
Ache A C 5: 137,290,763 I244L probably benign Het
Ankrd13d A T 19: 4,282,222 V58D probably damaging Het
Ano3 A G 2: 110,666,437 L789S probably damaging Het
Atp2a3 T C 11: 72,972,464 V129A probably damaging Het
Cldn11 T C 3: 31,163,261 S193P possibly damaging Het
Clpb A T 7: 101,711,418 R218S probably benign Het
Cntln A G 4: 84,957,021 S231G probably benign Het
Cntn4 T C 6: 106,662,630 Y574H probably damaging Het
Col6a3 C T 1: 90,781,801 R2498H unknown Het
Ctdnep1 T C 11: 69,984,768 V108A probably damaging Het
Cyp2c67 A T 19: 39,638,734 N217K probably damaging Het
Dao T A 5: 114,009,840 M1K probably null Het
Dchs1 A G 7: 105,765,774 probably null Het
Dennd4a A T 9: 64,912,692 I1809L probably benign Het
Dnah7a T A 1: 53,528,899 probably null Het
Epn1 A T 7: 5,083,721 probably benign Het
Erich1 A G 8: 14,030,719 S267P probably damaging Het
Gm17732 G T 18: 62,662,865 V41L probably damaging Het
Gpaa1 C A 15: 76,334,626 T556K possibly damaging Het
Gpr65 T A 12: 98,275,264 S59T probably damaging Het
Hydin T C 8: 110,398,063 V568A possibly damaging Het
Ifi205 T C 1: 174,026,655 D144G probably benign Het
Itga1 T C 13: 114,970,576 H993R probably benign Het
Itgax T C 7: 128,148,763 L1075P possibly damaging Het
Itpr1 T A 6: 108,349,677 V120E probably damaging Het
Kdm3b T C 18: 34,837,665 S1762P probably damaging Het
Krt80 T A 15: 101,350,097 T221S unknown Het
Lama2 T C 10: 27,118,624 D1763G probably benign Het
Lrp5 T C 19: 3,620,286 D606G probably benign Het
Map6d1 T C 16: 20,241,183 D44G probably benign Het
Mtmr11 T A 3: 96,165,055 I282K probably benign Het
Nalcn G A 14: 123,278,301 T1696M possibly damaging Het
Nup214 T C 2: 32,034,232 V1591A probably benign Het
Oas1f C A 5: 120,848,180 Y65* probably null Het
Olfr1375 T A 11: 51,048,835 C243S probably damaging Het
Olfr224 T A 11: 58,566,857 T163S possibly damaging Het
Olfr325 T C 11: 58,581,810 V322A probably benign Het
Olfr482 A T 7: 108,095,264 I102K possibly damaging Het
Olfr585 A T 7: 103,097,764 T8S probably benign Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pigyl A G 9: 22,158,028 I12V probably benign Het
Pno1 A T 11: 17,208,791 D202E probably benign Het
Ppp5c A T 7: 17,009,924 M195K probably damaging Het
Prrc2a A T 17: 35,150,622 F1905Y possibly damaging Het
Ptpn11 C A 5: 121,144,618 D435Y probably damaging Het
Rbm33 A G 5: 28,339,166 Y140C probably damaging Het
Runx1t1 A G 4: 13,865,225 E339G possibly damaging Het
Scube3 G T 17: 28,164,696 K480N possibly damaging Het
Sephs1 T A 2: 4,905,658 M313K probably benign Het
Tcaim T C 9: 122,826,930 W304R probably damaging Het
Terf2ip C T 8: 112,011,882 T134I probably damaging Het
Terf2ip A G 8: 112,017,896 T282A probably benign Het
Tnfrsf18 G T 4: 156,027,991 A102S probably benign Het
Triqk A G 4: 12,962,987 T9A probably benign Het
Tshz2 G A 2: 169,884,093 S203N probably benign Het
Zc3h13 G A 14: 75,323,688 V573I unknown Het
Zfhx4 A G 3: 5,241,773 K20E probably damaging Het
Zfhx4 A G 3: 5,400,335 D1876G probably benign Het
Other mutations in Trim10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Trim10 APN 17 36877248 missense probably benign 0.03
IGL00501:Trim10 APN 17 36877047 missense probably benign 0.08
IGL00846:Trim10 APN 17 36871692 missense probably damaging 1.00
IGL01536:Trim10 APN 17 36877288 splice site probably null
IGL02814:Trim10 APN 17 36877336 nonsense probably null
IGL03135:Trim10 APN 17 36874221 missense possibly damaging 0.78
IGL03144:Trim10 APN 17 36876848 missense probably damaging 1.00
IGL03298:Trim10 APN 17 36877025 missense possibly damaging 0.87
PIT4378001:Trim10 UTSW 17 36877128 missense probably damaging 0.98
R0102:Trim10 UTSW 17 36870182 missense probably damaging 1.00
R0102:Trim10 UTSW 17 36870182 missense probably damaging 1.00
R0834:Trim10 UTSW 17 36872391 missense probably benign 0.00
R1517:Trim10 UTSW 17 36872454 missense probably damaging 1.00
R1691:Trim10 UTSW 17 36876899 missense probably damaging 1.00
R1696:Trim10 UTSW 17 36877181 nonsense probably null
R2149:Trim10 UTSW 17 36877014 missense probably benign 0.18
R3153:Trim10 UTSW 17 36871688 missense probably damaging 1.00
R3154:Trim10 UTSW 17 36871688 missense probably damaging 1.00
R5156:Trim10 UTSW 17 36877056 missense probably damaging 0.99
R5327:Trim10 UTSW 17 36870189 missense probably damaging 1.00
R5361:Trim10 UTSW 17 36875436 missense probably benign 0.03
R5758:Trim10 UTSW 17 36877152 missense possibly damaging 0.80
R5764:Trim10 UTSW 17 36870181 missense probably damaging 0.97
R6032:Trim10 UTSW 17 36871714 missense possibly damaging 0.87
R6032:Trim10 UTSW 17 36871714 missense possibly damaging 0.87
R6179:Trim10 UTSW 17 36877031 missense probably damaging 1.00
R6709:Trim10 UTSW 17 36872370 missense probably damaging 0.99
R7172:Trim10 UTSW 17 36870063 missense possibly damaging 0.78
R7197:Trim10 UTSW 17 36876954 missense probably damaging 1.00
R7390:Trim10 UTSW 17 36869881 start codon destroyed probably null 0.98
R7391:Trim10 UTSW 17 36869881 start codon destroyed probably null 0.98
R7696:Trim10 UTSW 17 36871752 missense probably damaging 1.00
R8830:Trim10 UTSW 17 36869954 missense probably damaging 1.00
R8867:Trim10 UTSW 17 36870156 missense probably benign 0.00
R8970:Trim10 UTSW 17 36873276 missense probably benign 0.00
R9635:Trim10 UTSW 17 36876998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTTAATGTCCAAGGCTG -3'
(R):5'- TGCTGCACAAGTGGGTAGATC -3'

Sequencing Primer
(F):5'- GTCTTAATGTCCAAGGCTGGGAATAC -3'
(R):5'- GTGGGTAGATCTACAGCACTATC -3'
Posted On 2022-04-18