Incidental Mutation 'R9376:Cyp2c67'
ID 709656
Institutional Source Beutler Lab
Gene Symbol Cyp2c67
Ensembl Gene ENSMUSG00000062624
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms C730004C24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R9376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 39608842-39649051 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39638734 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 217 (N217K)
Ref Sequence ENSEMBL: ENSMUSP00000065796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067328]
AlphaFold Q569X9
Predicted Effect probably damaging
Transcript: ENSMUST00000067328
AA Change: N217K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065796
Gene: ENSMUSG00000062624
AA Change: N217K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 8.5e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,294,215 L1296H probably damaging Het
Abcb4 A T 5: 8,958,988 D1215V probably damaging Het
Ache A C 5: 137,290,763 I244L probably benign Het
Ankrd13d A T 19: 4,282,222 V58D probably damaging Het
Ano3 A G 2: 110,666,437 L789S probably damaging Het
Atp2a3 T C 11: 72,972,464 V129A probably damaging Het
Cldn11 T C 3: 31,163,261 S193P possibly damaging Het
Clpb A T 7: 101,711,418 R218S probably benign Het
Cntln A G 4: 84,957,021 S231G probably benign Het
Cntn4 T C 6: 106,662,630 Y574H probably damaging Het
Col6a3 C T 1: 90,781,801 R2498H unknown Het
Ctdnep1 T C 11: 69,984,768 V108A probably damaging Het
Dao T A 5: 114,009,840 M1K probably null Het
Dchs1 A G 7: 105,765,774 probably null Het
Dennd4a A T 9: 64,912,692 I1809L probably benign Het
Dnah7a T A 1: 53,528,899 probably null Het
Epn1 A T 7: 5,083,721 probably benign Het
Erich1 A G 8: 14,030,719 S267P probably damaging Het
Gm17732 G T 18: 62,662,865 V41L probably damaging Het
Gpaa1 C A 15: 76,334,626 T556K possibly damaging Het
Gpr65 T A 12: 98,275,264 S59T probably damaging Het
Hydin T C 8: 110,398,063 V568A possibly damaging Het
Ifi205 T C 1: 174,026,655 D144G probably benign Het
Itga1 T C 13: 114,970,576 H993R probably benign Het
Itgax T C 7: 128,148,763 L1075P possibly damaging Het
Itpr1 T A 6: 108,349,677 V120E probably damaging Het
Kdm3b T C 18: 34,837,665 S1762P probably damaging Het
Krt80 T A 15: 101,350,097 T221S unknown Het
Lama2 T C 10: 27,118,624 D1763G probably benign Het
Lrp5 T C 19: 3,620,286 D606G probably benign Het
Map6d1 T C 16: 20,241,183 D44G probably benign Het
Mtmr11 T A 3: 96,165,055 I282K probably benign Het
Nalcn G A 14: 123,278,301 T1696M possibly damaging Het
Nup214 T C 2: 32,034,232 V1591A probably benign Het
Oas1f C A 5: 120,848,180 Y65* probably null Het
Olfr1375 T A 11: 51,048,835 C243S probably damaging Het
Olfr224 T A 11: 58,566,857 T163S possibly damaging Het
Olfr325 T C 11: 58,581,810 V322A probably benign Het
Olfr482 A T 7: 108,095,264 I102K possibly damaging Het
Olfr585 A T 7: 103,097,764 T8S probably benign Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pigyl A G 9: 22,158,028 I12V probably benign Het
Pno1 A T 11: 17,208,791 D202E probably benign Het
Ppp5c A T 7: 17,009,924 M195K probably damaging Het
Prrc2a A T 17: 35,150,622 F1905Y possibly damaging Het
Ptpn11 C A 5: 121,144,618 D435Y probably damaging Het
Rbm33 A G 5: 28,339,166 Y140C probably damaging Het
Runx1t1 A G 4: 13,865,225 E339G possibly damaging Het
Scube3 G T 17: 28,164,696 K480N possibly damaging Het
Sephs1 T A 2: 4,905,658 M313K probably benign Het
Tcaim T C 9: 122,826,930 W304R probably damaging Het
Terf2ip C T 8: 112,011,882 T134I probably damaging Het
Terf2ip A G 8: 112,017,896 T282A probably benign Het
Tnfrsf18 G T 4: 156,027,991 A102S probably benign Het
Trim10 A T 17: 36,873,276 I254F probably benign Het
Triqk A G 4: 12,962,987 T9A probably benign Het
Tshz2 G A 2: 169,884,093 S203N probably benign Het
Zc3h13 G A 14: 75,323,688 V573I unknown Het
Zfhx4 A G 3: 5,241,773 K20E probably damaging Het
Zfhx4 A G 3: 5,400,335 D1876G probably benign Het
Other mutations in Cyp2c67
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Cyp2c67 APN 19 39643385 missense possibly damaging 0.95
IGL01025:Cyp2c67 APN 19 39639932 nonsense probably null
IGL01363:Cyp2c67 APN 19 39639967 missense probably damaging 0.99
IGL01819:Cyp2c67 APN 19 39615721 missense probably damaging 0.98
IGL01902:Cyp2c67 APN 19 39649026 missense probably damaging 1.00
IGL02172:Cyp2c67 APN 19 39649002 missense possibly damaging 0.76
IGL02351:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02355:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02355:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02358:Cyp2c67 APN 19 39617417 missense probably damaging 1.00
IGL02362:Cyp2c67 APN 19 39643405 missense probably benign 0.34
IGL02362:Cyp2c67 APN 19 39617382 nonsense probably null
IGL02388:Cyp2c67 APN 19 39643355 missense probably benign 0.20
IGL03106:Cyp2c67 APN 19 39643675 missense probably benign 0.27
IGL03219:Cyp2c67 APN 19 39643294 missense possibly damaging 0.54
IGL03326:Cyp2c67 APN 19 39643269 critical splice donor site probably null
IGL03349:Cyp2c67 APN 19 39643684 missense probably damaging 1.00
IGL03356:Cyp2c67 APN 19 39639961 missense probably damaging 1.00
IGL03052:Cyp2c67 UTSW 19 39648885 missense possibly damaging 0.88
R0585:Cyp2c67 UTSW 19 39638694 missense possibly damaging 0.59
R0975:Cyp2c67 UTSW 19 39609178 missense possibly damaging 0.49
R0976:Cyp2c67 UTSW 19 39643374 missense probably damaging 1.00
R1252:Cyp2c67 UTSW 19 39626141 missense possibly damaging 0.93
R1398:Cyp2c67 UTSW 19 39638625 missense probably damaging 0.96
R1411:Cyp2c67 UTSW 19 39638591 missense probably damaging 1.00
R1505:Cyp2c67 UTSW 19 39648964 missense probably benign 0.00
R1543:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1613:Cyp2c67 UTSW 19 39626199 missense probably benign 0.00
R1618:Cyp2c67 UTSW 19 39643264 splice site probably benign
R1667:Cyp2c67 UTSW 19 39643590 critical splice donor site probably null
R1852:Cyp2c67 UTSW 19 39617367 missense probably benign 0.01
R2005:Cyp2c67 UTSW 19 39643345 missense probably damaging 1.00
R2105:Cyp2c67 UTSW 19 39626237 missense probably benign 0.24
R2181:Cyp2c67 UTSW 19 39609097 missense possibly damaging 0.94
R3817:Cyp2c67 UTSW 19 39638683 missense probably benign 0.00
R4669:Cyp2c67 UTSW 19 39643654 missense probably benign 0.00
R4689:Cyp2c67 UTSW 19 39638588 missense probably benign 0.00
R4756:Cyp2c67 UTSW 19 39643744 missense probably benign 0.03
R4823:Cyp2c67 UTSW 19 39615724 missense probably benign 0.13
R5152:Cyp2c67 UTSW 19 39638688 missense probably benign 0.00
R5345:Cyp2c67 UTSW 19 39626232 missense probably benign 0.01
R5580:Cyp2c67 UTSW 19 39615650 missense probably damaging 0.99
R5644:Cyp2c67 UTSW 19 39615694 missense possibly damaging 0.84
R6116:Cyp2c67 UTSW 19 39617435 missense probably damaging 1.00
R6516:Cyp2c67 UTSW 19 39617429 missense probably damaging 1.00
R6550:Cyp2c67 UTSW 19 39617410 nonsense probably null
R6939:Cyp2c67 UTSW 19 39643334 missense possibly damaging 0.68
R6995:Cyp2c67 UTSW 19 39615679 missense probably damaging 0.96
R7028:Cyp2c67 UTSW 19 39639897 missense possibly damaging 0.68
R7144:Cyp2c67 UTSW 19 39615694 missense probably benign 0.00
R7242:Cyp2c67 UTSW 19 39617339 missense probably benign 0.30
R7335:Cyp2c67 UTSW 19 39640007 nonsense probably null
R7337:Cyp2c67 UTSW 19 39609264 splice site probably null
R7474:Cyp2c67 UTSW 19 39617432 missense probably null 0.05
R7642:Cyp2c67 UTSW 19 39615640 missense probably damaging 0.97
R7870:Cyp2c67 UTSW 19 39609225 missense probably damaging 1.00
R8152:Cyp2c67 UTSW 19 39640008 missense probably benign 0.21
R8367:Cyp2c67 UTSW 19 39638674 missense probably benign 0.01
R8717:Cyp2c67 UTSW 19 39638711 missense probably benign 0.05
R8728:Cyp2c67 UTSW 19 39626161 missense probably damaging 1.00
R9275:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
R9278:Cyp2c67 UTSW 19 39609255 missense probably damaging 1.00
Z1177:Cyp2c67 UTSW 19 39643679 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAATGAACTCTACAGTCCATGAC -3'
(R):5'- GGTTATTCAAACGTGTAGAACAGAG -3'

Sequencing Primer
(F):5'- TGAACTCTACAGTCCATGACAAGTC -3'
(R):5'- ACACTCAAAAGATATGTGAGTGTG -3'
Posted On 2022-04-18