Incidental Mutation 'R9377:Myo3b'
ID 709665
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9377 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70069242 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 522 (V522I)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect possibly damaging
Transcript: ENSMUST00000060208
AA Change: V522I

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: V522I

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112243
AA Change: V494I

PolyPhen 2 Score 0.546 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: V494I

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,348,273 (GRCm39) T55A probably benign Het
3110070M22Rik T A 13: 119,624,822 (GRCm39) probably benign Het
Acot12 T A 13: 91,918,221 (GRCm39) N171K probably benign Het
Adam18 G A 8: 25,104,859 (GRCm39) Q652* probably null Het
Adgrv1 T C 13: 81,705,277 (GRCm39) E791G probably damaging Het
Aff1 C T 5: 103,981,685 (GRCm39) S608L probably damaging Het
Amfr A T 8: 94,707,018 (GRCm39) F432L probably damaging Het
Ankfn1 G A 11: 89,332,284 (GRCm39) L421F possibly damaging Het
Ankrd31 T C 13: 97,014,733 (GRCm39) V1334A probably benign Het
Ascc3 C T 10: 50,608,858 (GRCm39) H1534Y possibly damaging Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Atf3 T C 1: 190,909,510 (GRCm39) H53R probably benign Het
Bsn C A 9: 107,990,800 (GRCm39) V1651F probably damaging Het
Bsn A T 9: 107,993,361 (GRCm39) L797Q probably damaging Het
Bzw2 T C 12: 36,180,131 (GRCm39) D32G probably damaging Het
Cacna1e A T 1: 154,361,458 (GRCm39) M531K possibly damaging Het
Cep120 A G 18: 53,851,592 (GRCm39) F567L possibly damaging Het
Cit T C 5: 116,084,914 (GRCm39) I815T probably benign Het
Cnot6l G T 5: 96,276,826 (GRCm39) Q121K probably benign Het
Col4a2 G A 8: 11,483,725 (GRCm39) G882R probably damaging Het
Col6a3 A G 1: 90,743,961 (GRCm39) F536L probably damaging Het
Copg2 T A 6: 30,793,721 (GRCm39) H394L possibly damaging Het
Cst13 A G 2: 148,670,165 (GRCm39) M112V possibly damaging Het
Cyp2j7 G T 4: 96,124,786 (GRCm39) N37K probably benign Het
Cyp2u1 T A 3: 131,091,449 (GRCm39) N357I possibly damaging Het
Dars1 T C 1: 128,344,945 (GRCm39) T4A probably benign Het
Dclk1 G T 3: 55,429,374 (GRCm39) C414F possibly damaging Het
Dmbt1 A T 7: 130,694,832 (GRCm39) Y1009F unknown Het
Ebf4 T C 2: 130,148,775 (GRCm39) Y117H probably damaging Het
Eif2b4 A G 5: 31,348,500 (GRCm39) Y196H probably benign Het
Enpp2 C T 15: 54,739,080 (GRCm39) R401H probably damaging Het
Epo T C 5: 137,484,017 (GRCm39) probably benign Het
Gli1 T A 10: 127,173,359 (GRCm39) T100S possibly damaging Het
Gml2 T A 15: 74,695,957 (GRCm39) F117Y probably benign Het
Hivep1 T C 13: 42,335,403 (GRCm39) V2314A probably benign Het
Hspb8 A G 5: 116,547,487 (GRCm39) I165T probably damaging Het
Itgax A T 7: 127,732,849 (GRCm39) T243S probably benign Het
Itih4 G T 14: 30,608,533 (GRCm39) L16F probably damaging Het
Kmt5a C T 5: 124,578,064 (GRCm39) probably benign Het
Lamc1 T C 1: 153,115,009 (GRCm39) E1089G probably benign Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mcmbp A T 7: 128,317,803 (GRCm39) N147K probably benign Het
Mical2 C T 7: 111,981,246 (GRCm39) L407F probably benign Het
Mybpc2 A T 7: 44,158,999 (GRCm39) V653D probably benign Het
Nbr1 A G 11: 101,456,590 (GRCm39) T156A possibly damaging Het
Neb T A 2: 52,039,291 (GRCm39) probably null Het
Neb T A 2: 52,116,546 (GRCm39) Y964F Het
Nr2f2 T A 7: 70,007,856 (GRCm39) I209F probably damaging Het
Nwd2 A G 5: 63,957,740 (GRCm39) T357A probably damaging Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Pcdhb19 T A 18: 37,632,299 (GRCm39) V698E probably damaging Het
Pcdhga6 C T 18: 37,841,570 (GRCm39) P430L probably damaging Het
Piezo2 A G 18: 63,162,156 (GRCm39) L2225S possibly damaging Het
Plekhf1 A T 7: 37,921,203 (GRCm39) W122R probably damaging Het
Pold3 A G 7: 99,732,993 (GRCm39) S418P possibly damaging Het
Poldip3 T C 15: 83,019,589 (GRCm39) N180S probably benign Het
Ppp1r21 C T 17: 88,852,815 (GRCm39) R65* probably null Het
Ppp1r3d A T 2: 178,055,669 (GRCm39) V111E probably damaging Het
Prrg4 T C 2: 104,669,728 (GRCm39) I130V probably benign Het
Psma5 A T 3: 108,172,448 (GRCm39) T55S probably benign Het
Rbm5 C A 9: 107,627,252 (GRCm39) A440S probably benign Het
Rdx A G 9: 51,980,168 (GRCm39) K254E possibly damaging Het
Rere A C 4: 150,593,342 (GRCm39) Q312P unknown Het
Rest T C 5: 77,416,128 (GRCm39) V114A possibly damaging Het
Rufy4 G T 1: 74,171,879 (GRCm39) V201L probably benign Het
Scyl1 T C 19: 5,809,023 (GRCm39) E727G probably benign Het
Serpinb6b T A 13: 33,152,494 (GRCm39) M1K probably null Het
Sgsm1 C A 5: 113,436,741 (GRCm39) V30F probably damaging Het
Skap1 A G 11: 96,644,921 (GRCm39) D344G possibly damaging Het
Slc26a7 T C 4: 14,516,189 (GRCm39) T547A probably benign Het
Slc6a3 C A 13: 73,692,966 (GRCm39) S195R probably benign Het
Sorbs1 T C 19: 40,387,048 (GRCm39) D6G probably damaging Het
Spock3 A T 8: 63,798,746 (GRCm39) M253L probably damaging Het
Ssh2 A G 11: 77,298,974 (GRCm39) Y107C possibly damaging Het
Svil T C 18: 5,057,294 (GRCm39) S581P probably benign Het
Tbc1d14 T C 5: 36,662,472 (GRCm39) T553A probably benign Het
Tet3 T A 6: 83,380,596 (GRCm39) Q524L possibly damaging Het
Uckl1 A T 2: 181,211,532 (GRCm39) V456E probably damaging Het
Ucp2 T C 7: 100,146,040 (GRCm39) F4S probably benign Het
Vmn2r77 A G 7: 86,444,442 (GRCm39) I32V probably benign Het
Vmn2r89 T A 14: 51,692,601 (GRCm39) Y135N probably benign Het
Vtn A G 11: 78,390,587 (GRCm39) E82G probably benign Het
Zfp758 A G 17: 22,593,925 (GRCm39) N137S probably benign Het
Zgpat T A 2: 181,021,646 (GRCm39) C357* probably null Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCAGCATCATTGGAGTG -3'
(R):5'- AAATCAGCTACCACTGCTCCTTTG -3'

Sequencing Primer
(F):5'- ATCATTGGAGTGCGGCCTC -3'
(R):5'- TACGCTGCCTGCTGTATA -3'
Posted On 2022-04-18