Incidental Mutation 'R9377:Sgsm1'
ID 709684
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, D5Bwg1524e, 2410098H20Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9377 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 113391086-113458652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 113436741 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 30 (V30F)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048112
AA Change: V30F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: V30F

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112325
AA Change: V30F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: V30F

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000154248
AA Change: V30F

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: V30F

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,348,273 (GRCm39) T55A probably benign Het
3110070M22Rik T A 13: 119,624,822 (GRCm39) probably benign Het
Acot12 T A 13: 91,918,221 (GRCm39) N171K probably benign Het
Adam18 G A 8: 25,104,859 (GRCm39) Q652* probably null Het
Adgrv1 T C 13: 81,705,277 (GRCm39) E791G probably damaging Het
Aff1 C T 5: 103,981,685 (GRCm39) S608L probably damaging Het
Amfr A T 8: 94,707,018 (GRCm39) F432L probably damaging Het
Ankfn1 G A 11: 89,332,284 (GRCm39) L421F possibly damaging Het
Ankrd31 T C 13: 97,014,733 (GRCm39) V1334A probably benign Het
Ascc3 C T 10: 50,608,858 (GRCm39) H1534Y possibly damaging Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Atf3 T C 1: 190,909,510 (GRCm39) H53R probably benign Het
Bsn C A 9: 107,990,800 (GRCm39) V1651F probably damaging Het
Bsn A T 9: 107,993,361 (GRCm39) L797Q probably damaging Het
Bzw2 T C 12: 36,180,131 (GRCm39) D32G probably damaging Het
Cacna1e A T 1: 154,361,458 (GRCm39) M531K possibly damaging Het
Cep120 A G 18: 53,851,592 (GRCm39) F567L possibly damaging Het
Cit T C 5: 116,084,914 (GRCm39) I815T probably benign Het
Cnot6l G T 5: 96,276,826 (GRCm39) Q121K probably benign Het
Col4a2 G A 8: 11,483,725 (GRCm39) G882R probably damaging Het
Col6a3 A G 1: 90,743,961 (GRCm39) F536L probably damaging Het
Copg2 T A 6: 30,793,721 (GRCm39) H394L possibly damaging Het
Cst13 A G 2: 148,670,165 (GRCm39) M112V possibly damaging Het
Cyp2j7 G T 4: 96,124,786 (GRCm39) N37K probably benign Het
Cyp2u1 T A 3: 131,091,449 (GRCm39) N357I possibly damaging Het
Dars1 T C 1: 128,344,945 (GRCm39) T4A probably benign Het
Dclk1 G T 3: 55,429,374 (GRCm39) C414F possibly damaging Het
Dmbt1 A T 7: 130,694,832 (GRCm39) Y1009F unknown Het
Ebf4 T C 2: 130,148,775 (GRCm39) Y117H probably damaging Het
Eif2b4 A G 5: 31,348,500 (GRCm39) Y196H probably benign Het
Enpp2 C T 15: 54,739,080 (GRCm39) R401H probably damaging Het
Epo T C 5: 137,484,017 (GRCm39) probably benign Het
Gli1 T A 10: 127,173,359 (GRCm39) T100S possibly damaging Het
Gml2 T A 15: 74,695,957 (GRCm39) F117Y probably benign Het
Hivep1 T C 13: 42,335,403 (GRCm39) V2314A probably benign Het
Hspb8 A G 5: 116,547,487 (GRCm39) I165T probably damaging Het
Itgax A T 7: 127,732,849 (GRCm39) T243S probably benign Het
Itih4 G T 14: 30,608,533 (GRCm39) L16F probably damaging Het
Kmt5a C T 5: 124,578,064 (GRCm39) probably benign Het
Lamc1 T C 1: 153,115,009 (GRCm39) E1089G probably benign Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mcmbp A T 7: 128,317,803 (GRCm39) N147K probably benign Het
Mical2 C T 7: 111,981,246 (GRCm39) L407F probably benign Het
Mybpc2 A T 7: 44,158,999 (GRCm39) V653D probably benign Het
Myo3b G A 2: 70,069,242 (GRCm39) V522I possibly damaging Het
Nbr1 A G 11: 101,456,590 (GRCm39) T156A possibly damaging Het
Neb T A 2: 52,116,546 (GRCm39) Y964F Het
Neb T A 2: 52,039,291 (GRCm39) probably null Het
Nr2f2 T A 7: 70,007,856 (GRCm39) I209F probably damaging Het
Nwd2 A G 5: 63,957,740 (GRCm39) T357A probably damaging Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Pcdhb19 T A 18: 37,632,299 (GRCm39) V698E probably damaging Het
Pcdhga6 C T 18: 37,841,570 (GRCm39) P430L probably damaging Het
Piezo2 A G 18: 63,162,156 (GRCm39) L2225S possibly damaging Het
Plekhf1 A T 7: 37,921,203 (GRCm39) W122R probably damaging Het
Pold3 A G 7: 99,732,993 (GRCm39) S418P possibly damaging Het
Poldip3 T C 15: 83,019,589 (GRCm39) N180S probably benign Het
Ppp1r21 C T 17: 88,852,815 (GRCm39) R65* probably null Het
Ppp1r3d A T 2: 178,055,669 (GRCm39) V111E probably damaging Het
Prrg4 T C 2: 104,669,728 (GRCm39) I130V probably benign Het
Psma5 A T 3: 108,172,448 (GRCm39) T55S probably benign Het
Rbm5 C A 9: 107,627,252 (GRCm39) A440S probably benign Het
Rdx A G 9: 51,980,168 (GRCm39) K254E possibly damaging Het
Rere A C 4: 150,593,342 (GRCm39) Q312P unknown Het
Rest T C 5: 77,416,128 (GRCm39) V114A possibly damaging Het
Rufy4 G T 1: 74,171,879 (GRCm39) V201L probably benign Het
Scyl1 T C 19: 5,809,023 (GRCm39) E727G probably benign Het
Serpinb6b T A 13: 33,152,494 (GRCm39) M1K probably null Het
Skap1 A G 11: 96,644,921 (GRCm39) D344G possibly damaging Het
Slc26a7 T C 4: 14,516,189 (GRCm39) T547A probably benign Het
Slc6a3 C A 13: 73,692,966 (GRCm39) S195R probably benign Het
Sorbs1 T C 19: 40,387,048 (GRCm39) D6G probably damaging Het
Spock3 A T 8: 63,798,746 (GRCm39) M253L probably damaging Het
Ssh2 A G 11: 77,298,974 (GRCm39) Y107C possibly damaging Het
Svil T C 18: 5,057,294 (GRCm39) S581P probably benign Het
Tbc1d14 T C 5: 36,662,472 (GRCm39) T553A probably benign Het
Tet3 T A 6: 83,380,596 (GRCm39) Q524L possibly damaging Het
Uckl1 A T 2: 181,211,532 (GRCm39) V456E probably damaging Het
Ucp2 T C 7: 100,146,040 (GRCm39) F4S probably benign Het
Vmn2r77 A G 7: 86,444,442 (GRCm39) I32V probably benign Het
Vmn2r89 T A 14: 51,692,601 (GRCm39) Y135N probably benign Het
Vtn A G 11: 78,390,587 (GRCm39) E82G probably benign Het
Zfp758 A G 17: 22,593,925 (GRCm39) N137S probably benign Het
Zgpat T A 2: 181,021,646 (GRCm39) C357* probably null Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113,392,930 (GRCm39) missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113,424,008 (GRCm39) missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113,424,048 (GRCm39) splice site probably benign
IGL01602:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113,433,531 (GRCm39) missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113,411,356 (GRCm39) missense probably benign
IGL01920:Sgsm1 APN 5 113,421,471 (GRCm39) missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL02387:Sgsm1 APN 5 113,400,929 (GRCm39) missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113,434,633 (GRCm39) splice site probably benign
IGL03177:Sgsm1 APN 5 113,398,859 (GRCm39) missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113,432,887 (GRCm39) missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113,403,182 (GRCm39) missense possibly damaging 0.67
caliente UTSW 5 113,428,328 (GRCm39) intron probably benign
Chili UTSW 5 113,405,989 (GRCm39) intron probably benign
pimiento UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113,416,616 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113,432,953 (GRCm39) missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113,436,702 (GRCm39) missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113,427,136 (GRCm39) splice site probably benign
R0099:Sgsm1 UTSW 5 113,422,226 (GRCm39) splice site probably benign
R0269:Sgsm1 UTSW 5 113,434,795 (GRCm39) critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113,411,571 (GRCm39) missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113,436,701 (GRCm39) missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113,411,625 (GRCm39) missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113,458,428 (GRCm39) missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113,392,894 (GRCm39) missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113,432,989 (GRCm39) splice site probably benign
R0744:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113,427,050 (GRCm39) missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113,406,708 (GRCm39) missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113,413,740 (GRCm39) missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113,427,351 (GRCm39) missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113,421,577 (GRCm39) nonsense probably null
R1473:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113,411,135 (GRCm39) missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113,421,483 (GRCm39) missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113,411,381 (GRCm39) missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113,433,266 (GRCm39) missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113,411,125 (GRCm39) missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113,433,270 (GRCm39) missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113,405,989 (GRCm39) intron probably benign
R4558:Sgsm1 UTSW 5 113,405,977 (GRCm39) intron probably benign
R4610:Sgsm1 UTSW 5 113,403,173 (GRCm39) missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113,407,913 (GRCm39) critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113,430,492 (GRCm39) missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113,428,328 (GRCm39) intron probably benign
R4992:Sgsm1 UTSW 5 113,430,486 (GRCm39) missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113,398,905 (GRCm39) missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113,398,823 (GRCm39) missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113,398,822 (GRCm39) missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113,434,704 (GRCm39) missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113,430,522 (GRCm39) missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113,426,997 (GRCm39) critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113,428,246 (GRCm39) missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113,421,512 (GRCm39) missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113,416,712 (GRCm39) splice site probably null
R7387:Sgsm1 UTSW 5 113,411,566 (GRCm39) missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113,422,187 (GRCm39) missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113,427,501 (GRCm39) splice site probably null
R7624:Sgsm1 UTSW 5 113,422,201 (GRCm39) nonsense probably null
R7632:Sgsm1 UTSW 5 113,423,948 (GRCm39) missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113,400,890 (GRCm39) missense probably damaging 1.00
R7727:Sgsm1 UTSW 5 113,422,193 (GRCm39) missense possibly damaging 0.95
R7732:Sgsm1 UTSW 5 113,414,196 (GRCm39) missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113,430,510 (GRCm39) missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113,403,134 (GRCm39) missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113,398,877 (GRCm39) missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113,407,958 (GRCm39) missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113,411,284 (GRCm39) missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113,411,123 (GRCm39) missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113,435,097 (GRCm39) missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113,421,495 (GRCm39) missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113,432,861 (GRCm39) missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113,436,725 (GRCm39) missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113,430,577 (GRCm39) missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113,428,201 (GRCm39) missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113,422,139 (GRCm39) missense unknown
R9461:Sgsm1 UTSW 5 113,423,898 (GRCm39) critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113,427,097 (GRCm39) missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113,428,207 (GRCm39) missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113,458,418 (GRCm39) missense probably benign
Z1177:Sgsm1 UTSW 5 113,430,576 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGATCCCGAAATAACTCCAG -3'
(R):5'- TTCTGGAAGAGGTGACAGACC -3'

Sequencing Primer
(F):5'- CAGAGTCACAAAGCCCGGTG -3'
(R):5'- GGTGACAGACCTCCATGCAAATTAAG -3'
Posted On 2022-04-18