Incidental Mutation 'R9377:Bsn'
ID 709709
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Name bassoon
Synonyms presynaptic cytomatrix protein
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock # R9377 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 108096022-108190384 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 108113601 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 1651 (V1651F)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000035208
AA Change: V1651F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: V1651F

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,464 T55A probably benign Het
3110070M22Rik T A 13: 119,488,286 probably benign Het
Acot12 T A 13: 91,770,102 N171K probably benign Het
Adam18 G A 8: 24,614,843 Q652* probably null Het
Adgrv1 T C 13: 81,557,158 E791G probably damaging Het
Aff1 C T 5: 103,833,819 S608L probably damaging Het
Amfr A T 8: 93,980,390 F432L probably damaging Het
Ankfn1 G A 11: 89,441,458 L421F possibly damaging Het
Ankrd31 T C 13: 96,878,225 V1334A probably benign Het
Ascc3 C T 10: 50,732,762 H1534Y possibly damaging Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
Atf3 T C 1: 191,177,313 H53R probably benign Het
Bzw2 T C 12: 36,130,132 D32G probably damaging Het
Cacna1e A T 1: 154,485,712 M531K possibly damaging Het
Cep120 A G 18: 53,718,520 F567L possibly damaging Het
Cit T C 5: 115,946,855 I815T probably benign Het
Cnot6l G T 5: 96,128,967 Q121K probably benign Het
Col4a2 G A 8: 11,433,725 G882R probably damaging Het
Col6a3 A G 1: 90,816,239 F536L probably damaging Het
Copg2 T A 6: 30,816,786 H394L possibly damaging Het
Cst13 A G 2: 148,828,245 M112V possibly damaging Het
Cyp2j7 G T 4: 96,236,549 N37K probably benign Het
Cyp2u1 T A 3: 131,297,800 N357I possibly damaging Het
Dars T C 1: 128,417,208 T4A probably benign Het
Dclk1 G T 3: 55,521,953 C414F possibly damaging Het
Dmbt1 A T 7: 131,093,102 Y1009F unknown Het
Ebf4 T C 2: 130,306,855 Y117H probably damaging Het
Eif2b4 A G 5: 31,191,156 Y196H probably benign Het
Enpp2 C T 15: 54,875,684 R401H probably damaging Het
Epo T C 5: 137,485,755 probably benign Het
Gli1 T A 10: 127,337,490 T100S possibly damaging Het
Gml2 T A 15: 74,824,108 F117Y probably benign Het
Hivep1 T C 13: 42,181,927 V2314A probably benign Het
Hspb8 A G 5: 116,409,428 I165T probably damaging Het
Itgax A T 7: 128,133,677 T243S probably benign Het
Itih4 G T 14: 30,886,576 L16F probably damaging Het
Kmt5a C T 5: 124,440,001 probably benign Het
Lamc1 T C 1: 153,239,263 E1089G probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mcmbp A T 7: 128,716,079 N147K probably benign Het
Micalcl C T 7: 112,382,039 L407F probably benign Het
Mybpc2 A T 7: 44,509,575 V653D probably benign Het
Myo3b G A 2: 70,238,898 V522I possibly damaging Het
Nbr1 A G 11: 101,565,764 T156A possibly damaging Het
Neb T A 2: 52,226,534 Y964F Het
Neb T A 2: 52,149,279 probably null Het
Nr2f2 T A 7: 70,358,108 I209F probably damaging Het
Nwd2 A G 5: 63,800,397 T357A probably damaging Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pcdhb19 T A 18: 37,499,246 V698E probably damaging Het
Pcdhga6 C T 18: 37,708,517 P430L probably damaging Het
Piezo2 A G 18: 63,029,085 L2225S possibly damaging Het
Plekhf1 A T 7: 38,221,779 W122R probably damaging Het
Pold3 A G 7: 100,083,786 S418P possibly damaging Het
Poldip3 T C 15: 83,135,388 N180S probably benign Het
Ppp1r21 C T 17: 88,545,387 R65* probably null Het
Ppp1r3d A T 2: 178,413,876 V111E probably damaging Het
Prrg4 T C 2: 104,839,383 I130V probably benign Het
Psma5 A T 3: 108,265,132 T55S probably benign Het
Rbm5 C A 9: 107,750,053 A440S probably benign Het
Rdx A G 9: 52,068,868 K254E possibly damaging Het
Rere A C 4: 150,508,885 Q312P unknown Het
Rest T C 5: 77,268,281 V114A possibly damaging Het
Rufy4 G T 1: 74,132,720 V201L probably benign Het
Scyl1 T C 19: 5,758,995 E727G probably benign Het
Serpinb6b T A 13: 32,968,511 M1K probably null Het
Sgsm1 C A 5: 113,288,875 V30F probably damaging Het
Skap1 A G 11: 96,754,095 D344G possibly damaging Het
Slc26a7 T C 4: 14,516,189 T547A probably benign Het
Slc6a3 C A 13: 73,544,847 S195R probably benign Het
Sorbs1 T C 19: 40,398,604 D6G probably damaging Het
Spock3 A T 8: 63,345,712 M253L probably damaging Het
Ssh2 A G 11: 77,408,148 Y107C possibly damaging Het
Svil T C 18: 5,057,294 S581P probably benign Het
Tbc1d14 T C 5: 36,505,128 T553A probably benign Het
Tet3 T A 6: 83,403,614 Q524L possibly damaging Het
Uckl1 A T 2: 181,569,739 V456E probably damaging Het
Ucp2 T C 7: 100,496,833 F4S probably benign Het
Vmn2r77 A G 7: 86,795,234 I32V probably benign Het
Vmn2r89 T A 14: 51,455,144 Y135N probably benign Het
Vtn A G 11: 78,499,761 E82G probably benign Het
Zfp758 A G 17: 22,374,944 N137S probably benign Het
Zgpat T A 2: 181,379,853 C357* probably null Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7960:Bsn UTSW 9 108115548 missense probably damaging 1.00
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
R8158:Bsn UTSW 9 108110033 missense unknown
R8161:Bsn UTSW 9 108139530 missense probably benign 0.20
R8225:Bsn UTSW 9 108107106 missense
R8282:Bsn UTSW 9 108107691 missense possibly damaging 0.73
R8296:Bsn UTSW 9 108117379 missense probably benign 0.00
R8415:Bsn UTSW 9 108111452 missense probably benign 0.00
R8417:Bsn UTSW 9 108111452 missense probably benign 0.00
R8426:Bsn UTSW 9 108126573 missense probably damaging 1.00
R8437:Bsn UTSW 9 108111452 missense probably benign 0.00
R8438:Bsn UTSW 9 108111452 missense probably benign 0.00
R8439:Bsn UTSW 9 108111452 missense probably benign 0.00
R8440:Bsn UTSW 9 108111452 missense probably benign 0.00
R8441:Bsn UTSW 9 108111452 missense probably benign 0.00
R8442:Bsn UTSW 9 108111452 missense probably benign 0.00
R8513:Bsn UTSW 9 108114510 missense possibly damaging 0.65
R8529:Bsn UTSW 9 108111452 missense probably benign 0.00
R8535:Bsn UTSW 9 108111452 missense probably benign 0.00
R8546:Bsn UTSW 9 108111452 missense probably benign 0.00
R8548:Bsn UTSW 9 108111452 missense probably benign 0.00
R8549:Bsn UTSW 9 108111452 missense probably benign 0.00
R8682:Bsn UTSW 9 108106169 missense
R8773:Bsn UTSW 9 108110505 missense unknown
R8883:Bsn UTSW 9 108113028 missense probably damaging 0.98
R8906:Bsn UTSW 9 108107553 missense unknown
R9018:Bsn UTSW 9 108117289 missense probably benign 0.06
R9070:Bsn UTSW 9 108110096 missense
R9094:Bsn UTSW 9 108110853 missense unknown
R9098:Bsn UTSW 9 108112974 missense possibly damaging 0.65
R9128:Bsn UTSW 9 108116150 missense probably benign 0.21
R9162:Bsn UTSW 9 108110684 missense unknown
R9224:Bsn UTSW 9 108105487 missense
R9230:Bsn UTSW 9 108112260 missense probably damaging 1.00
R9233:Bsn UTSW 9 108117090 missense probably benign 0.28
R9245:Bsn UTSW 9 108116093 missense probably damaging 1.00
R9275:Bsn UTSW 9 108111620 missense probably damaging 1.00
R9307:Bsn UTSW 9 108115794 missense probably benign 0.01
R9343:Bsn UTSW 9 108115502 missense probably damaging 1.00
R9377:Bsn UTSW 9 108116162 missense probably damaging 1.00
R9378:Bsn UTSW 9 108107655 missense possibly damaging 0.85
R9408:Bsn UTSW 9 108139453 nonsense probably null
R9455:Bsn UTSW 9 108111332 missense unknown
R9563:Bsn UTSW 9 108107417 missense
R9615:Bsn UTSW 9 108107231 missense
R9656:Bsn UTSW 9 108117208 missense probably benign 0.09
R9698:Bsn UTSW 9 108115971 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATAACCAAAGGCTGCACAG -3'
(R):5'- TGCTCACCTACAGACTCTCAG -3'

Sequencing Primer
(F):5'- TTGACTGGCGTCCTGAGAC -3'
(R):5'- TACAGACTCTCAGCCCACCTC -3'
Posted On 2022-04-18