Incidental Mutation 'R9377:Serpinb6b'
ID 709720
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock # R9377 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation start codon destroyed
DNA Base Change (assembly) T to A at 32968511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000105922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably null
Transcript: ENSMUST00000017184
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842
AA Change: M1K

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110293
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: M1K

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164541
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,037,464 T55A probably benign Het
3110070M22Rik T A 13: 119,488,286 probably benign Het
Acot12 T A 13: 91,770,102 N171K probably benign Het
Adam18 G A 8: 24,614,843 Q652* probably null Het
Adgrv1 T C 13: 81,557,158 E791G probably damaging Het
Aff1 C T 5: 103,833,819 S608L probably damaging Het
Amfr A T 8: 93,980,390 F432L probably damaging Het
Ankfn1 G A 11: 89,441,458 L421F possibly damaging Het
Ankrd31 T C 13: 96,878,225 V1334A probably benign Het
Ascc3 C T 10: 50,732,762 H1534Y possibly damaging Het
Aste1 G A 9: 105,396,681 C40Y probably benign Het
Atf3 T C 1: 191,177,313 H53R probably benign Het
Bsn C A 9: 108,113,601 V1651F probably damaging Het
Bsn A T 9: 108,116,162 L797Q probably damaging Het
Bzw2 T C 12: 36,130,132 D32G probably damaging Het
Cacna1e A T 1: 154,485,712 M531K possibly damaging Het
Cep120 A G 18: 53,718,520 F567L possibly damaging Het
Cit T C 5: 115,946,855 I815T probably benign Het
Cnot6l G T 5: 96,128,967 Q121K probably benign Het
Col4a2 G A 8: 11,433,725 G882R probably damaging Het
Col6a3 A G 1: 90,816,239 F536L probably damaging Het
Copg2 T A 6: 30,816,786 H394L possibly damaging Het
Cst13 A G 2: 148,828,245 M112V possibly damaging Het
Cyp2j7 G T 4: 96,236,549 N37K probably benign Het
Cyp2u1 T A 3: 131,297,800 N357I possibly damaging Het
Dars T C 1: 128,417,208 T4A probably benign Het
Dclk1 G T 3: 55,521,953 C414F possibly damaging Het
Dmbt1 A T 7: 131,093,102 Y1009F unknown Het
Ebf4 T C 2: 130,306,855 Y117H probably damaging Het
Eif2b4 A G 5: 31,191,156 Y196H probably benign Het
Enpp2 C T 15: 54,875,684 R401H probably damaging Het
Epo T C 5: 137,485,755 probably benign Het
Gli1 T A 10: 127,337,490 T100S possibly damaging Het
Gml2 T A 15: 74,824,108 F117Y probably benign Het
Hivep1 T C 13: 42,181,927 V2314A probably benign Het
Hspb8 A G 5: 116,409,428 I165T probably damaging Het
Itgax A T 7: 128,133,677 T243S probably benign Het
Itih4 G T 14: 30,886,576 L16F probably damaging Het
Kmt5a C T 5: 124,440,001 probably benign Het
Lamc1 T C 1: 153,239,263 E1089G probably benign Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Mcmbp A T 7: 128,716,079 N147K probably benign Het
Micalcl C T 7: 112,382,039 L407F probably benign Het
Mybpc2 A T 7: 44,509,575 V653D probably benign Het
Myo3b G A 2: 70,238,898 V522I possibly damaging Het
Nbr1 A G 11: 101,565,764 T156A possibly damaging Het
Neb T A 2: 52,149,279 probably null Het
Neb T A 2: 52,226,534 Y964F Het
Nr2f2 T A 7: 70,358,108 I209F probably damaging Het
Nwd2 A G 5: 63,800,397 T357A probably damaging Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pcdhb19 T A 18: 37,499,246 V698E probably damaging Het
Pcdhga6 C T 18: 37,708,517 P430L probably damaging Het
Piezo2 A G 18: 63,029,085 L2225S possibly damaging Het
Plekhf1 A T 7: 38,221,779 W122R probably damaging Het
Pold3 A G 7: 100,083,786 S418P possibly damaging Het
Poldip3 T C 15: 83,135,388 N180S probably benign Het
Ppp1r21 C T 17: 88,545,387 R65* probably null Het
Ppp1r3d A T 2: 178,413,876 V111E probably damaging Het
Prrg4 T C 2: 104,839,383 I130V probably benign Het
Psma5 A T 3: 108,265,132 T55S probably benign Het
Rbm5 C A 9: 107,750,053 A440S probably benign Het
Rdx A G 9: 52,068,868 K254E possibly damaging Het
Rere A C 4: 150,508,885 Q312P unknown Het
Rest T C 5: 77,268,281 V114A possibly damaging Het
Rufy4 G T 1: 74,132,720 V201L probably benign Het
Scyl1 T C 19: 5,758,995 E727G probably benign Het
Sgsm1 C A 5: 113,288,875 V30F probably damaging Het
Skap1 A G 11: 96,754,095 D344G possibly damaging Het
Slc26a7 T C 4: 14,516,189 T547A probably benign Het
Slc6a3 C A 13: 73,544,847 S195R probably benign Het
Sorbs1 T C 19: 40,398,604 D6G probably damaging Het
Spock3 A T 8: 63,345,712 M253L probably damaging Het
Ssh2 A G 11: 77,408,148 Y107C possibly damaging Het
Svil T C 18: 5,057,294 S581P probably benign Het
Tbc1d14 T C 5: 36,505,128 T553A probably benign Het
Tet3 T A 6: 83,403,614 Q524L possibly damaging Het
Uckl1 A T 2: 181,569,739 V456E probably damaging Het
Ucp2 T C 7: 100,496,833 F4S probably benign Het
Vmn2r77 A G 7: 86,795,234 I32V probably benign Het
Vmn2r89 T A 14: 51,455,144 Y135N probably benign Het
Vtn A G 11: 78,499,761 E82G probably benign Het
Zfp758 A G 17: 22,374,944 N137S probably benign Het
Zgpat T A 2: 181,379,853 C357* probably null Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R5540:Serpinb6b UTSW 13 32977558 nonsense probably null
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- CCCAACAGGGCTTATCGTTTAATG -3'
(R):5'- GAGATCTGAACCAGCTCGACTG -3'

Sequencing Primer
(F):5'- ATGAGTGTGACTTTTACCTTCCATG -3'
(R):5'- CTGTGAAATGGAACTGGTTACC -3'
Posted On 2022-04-18