Incidental Mutation 'R9377:Poldip3'
ID 709731
Institutional Source Beutler Lab
Gene Symbol Poldip3
Ensembl Gene ENSMUSG00000041815
Gene Name polymerase (DNA-directed), delta interacting protein 3
Synonyms 1110008P04Rik, PDIP46
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.162) question?
Stock # R9377 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 83010177-83033585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83019589 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 180 (N180S)
Ref Sequence ENSEMBL: ENSMUSP00000054548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000129372]
AlphaFold Q8BG81
Predicted Effect probably benign
Transcript: ENSMUST00000058793
AA Change: N180S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815
AA Change: N180S

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100375
AA Change: N151S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815
AA Change: N151S

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129372
SMART Domains Protein: ENSMUSP00000120859
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 153 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700122O11Rik T C 17: 48,348,273 (GRCm39) T55A probably benign Het
3110070M22Rik T A 13: 119,624,822 (GRCm39) probably benign Het
Acot12 T A 13: 91,918,221 (GRCm39) N171K probably benign Het
Adam18 G A 8: 25,104,859 (GRCm39) Q652* probably null Het
Adgrv1 T C 13: 81,705,277 (GRCm39) E791G probably damaging Het
Aff1 C T 5: 103,981,685 (GRCm39) S608L probably damaging Het
Amfr A T 8: 94,707,018 (GRCm39) F432L probably damaging Het
Ankfn1 G A 11: 89,332,284 (GRCm39) L421F possibly damaging Het
Ankrd31 T C 13: 97,014,733 (GRCm39) V1334A probably benign Het
Ascc3 C T 10: 50,608,858 (GRCm39) H1534Y possibly damaging Het
Aste1 G A 9: 105,273,880 (GRCm39) C40Y probably benign Het
Atf3 T C 1: 190,909,510 (GRCm39) H53R probably benign Het
Bsn C A 9: 107,990,800 (GRCm39) V1651F probably damaging Het
Bsn A T 9: 107,993,361 (GRCm39) L797Q probably damaging Het
Bzw2 T C 12: 36,180,131 (GRCm39) D32G probably damaging Het
Cacna1e A T 1: 154,361,458 (GRCm39) M531K possibly damaging Het
Cep120 A G 18: 53,851,592 (GRCm39) F567L possibly damaging Het
Cit T C 5: 116,084,914 (GRCm39) I815T probably benign Het
Cnot6l G T 5: 96,276,826 (GRCm39) Q121K probably benign Het
Col4a2 G A 8: 11,483,725 (GRCm39) G882R probably damaging Het
Col6a3 A G 1: 90,743,961 (GRCm39) F536L probably damaging Het
Copg2 T A 6: 30,793,721 (GRCm39) H394L possibly damaging Het
Cst13 A G 2: 148,670,165 (GRCm39) M112V possibly damaging Het
Cyp2j7 G T 4: 96,124,786 (GRCm39) N37K probably benign Het
Cyp2u1 T A 3: 131,091,449 (GRCm39) N357I possibly damaging Het
Dars1 T C 1: 128,344,945 (GRCm39) T4A probably benign Het
Dclk1 G T 3: 55,429,374 (GRCm39) C414F possibly damaging Het
Dmbt1 A T 7: 130,694,832 (GRCm39) Y1009F unknown Het
Ebf4 T C 2: 130,148,775 (GRCm39) Y117H probably damaging Het
Eif2b4 A G 5: 31,348,500 (GRCm39) Y196H probably benign Het
Enpp2 C T 15: 54,739,080 (GRCm39) R401H probably damaging Het
Epo T C 5: 137,484,017 (GRCm39) probably benign Het
Gli1 T A 10: 127,173,359 (GRCm39) T100S possibly damaging Het
Gml2 T A 15: 74,695,957 (GRCm39) F117Y probably benign Het
Hivep1 T C 13: 42,335,403 (GRCm39) V2314A probably benign Het
Hspb8 A G 5: 116,547,487 (GRCm39) I165T probably damaging Het
Itgax A T 7: 127,732,849 (GRCm39) T243S probably benign Het
Itih4 G T 14: 30,608,533 (GRCm39) L16F probably damaging Het
Kmt5a C T 5: 124,578,064 (GRCm39) probably benign Het
Lamc1 T C 1: 153,115,009 (GRCm39) E1089G probably benign Het
Ltbp2 G A 12: 84,837,864 (GRCm39) P1192L probably benign Het
Mcmbp A T 7: 128,317,803 (GRCm39) N147K probably benign Het
Mical2 C T 7: 111,981,246 (GRCm39) L407F probably benign Het
Mybpc2 A T 7: 44,158,999 (GRCm39) V653D probably benign Het
Myo3b G A 2: 70,069,242 (GRCm39) V522I possibly damaging Het
Nbr1 A G 11: 101,456,590 (GRCm39) T156A possibly damaging Het
Neb T A 2: 52,039,291 (GRCm39) probably null Het
Neb T A 2: 52,116,546 (GRCm39) Y964F Het
Nr2f2 T A 7: 70,007,856 (GRCm39) I209F probably damaging Het
Nwd2 A G 5: 63,957,740 (GRCm39) T357A probably damaging Het
Palld C T 8: 61,969,691 (GRCm39) R1211H unknown Het
Pcdhb19 T A 18: 37,632,299 (GRCm39) V698E probably damaging Het
Pcdhga6 C T 18: 37,841,570 (GRCm39) P430L probably damaging Het
Piezo2 A G 18: 63,162,156 (GRCm39) L2225S possibly damaging Het
Plekhf1 A T 7: 37,921,203 (GRCm39) W122R probably damaging Het
Pold3 A G 7: 99,732,993 (GRCm39) S418P possibly damaging Het
Ppp1r21 C T 17: 88,852,815 (GRCm39) R65* probably null Het
Ppp1r3d A T 2: 178,055,669 (GRCm39) V111E probably damaging Het
Prrg4 T C 2: 104,669,728 (GRCm39) I130V probably benign Het
Psma5 A T 3: 108,172,448 (GRCm39) T55S probably benign Het
Rbm5 C A 9: 107,627,252 (GRCm39) A440S probably benign Het
Rdx A G 9: 51,980,168 (GRCm39) K254E possibly damaging Het
Rere A C 4: 150,593,342 (GRCm39) Q312P unknown Het
Rest T C 5: 77,416,128 (GRCm39) V114A possibly damaging Het
Rufy4 G T 1: 74,171,879 (GRCm39) V201L probably benign Het
Scyl1 T C 19: 5,809,023 (GRCm39) E727G probably benign Het
Serpinb6b T A 13: 33,152,494 (GRCm39) M1K probably null Het
Sgsm1 C A 5: 113,436,741 (GRCm39) V30F probably damaging Het
Skap1 A G 11: 96,644,921 (GRCm39) D344G possibly damaging Het
Slc26a7 T C 4: 14,516,189 (GRCm39) T547A probably benign Het
Slc6a3 C A 13: 73,692,966 (GRCm39) S195R probably benign Het
Sorbs1 T C 19: 40,387,048 (GRCm39) D6G probably damaging Het
Spock3 A T 8: 63,798,746 (GRCm39) M253L probably damaging Het
Ssh2 A G 11: 77,298,974 (GRCm39) Y107C possibly damaging Het
Svil T C 18: 5,057,294 (GRCm39) S581P probably benign Het
Tbc1d14 T C 5: 36,662,472 (GRCm39) T553A probably benign Het
Tet3 T A 6: 83,380,596 (GRCm39) Q524L possibly damaging Het
Uckl1 A T 2: 181,211,532 (GRCm39) V456E probably damaging Het
Ucp2 T C 7: 100,146,040 (GRCm39) F4S probably benign Het
Vmn2r77 A G 7: 86,444,442 (GRCm39) I32V probably benign Het
Vmn2r89 T A 14: 51,692,601 (GRCm39) Y135N probably benign Het
Vtn A G 11: 78,390,587 (GRCm39) E82G probably benign Het
Zfp758 A G 17: 22,593,925 (GRCm39) N137S probably benign Het
Zgpat T A 2: 181,021,646 (GRCm39) C357* probably null Het
Other mutations in Poldip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Poldip3 APN 15 83,022,680 (GRCm39) missense probably damaging 1.00
IGL02887:Poldip3 APN 15 83,013,469 (GRCm39) unclassified probably benign
R0143:Poldip3 UTSW 15 83,012,144 (GRCm39) missense probably damaging 1.00
R0201:Poldip3 UTSW 15 83,019,497 (GRCm39) missense probably benign 0.00
R0511:Poldip3 UTSW 15 83,022,436 (GRCm39) missense probably damaging 1.00
R1560:Poldip3 UTSW 15 83,022,527 (GRCm39) missense probably damaging 1.00
R2302:Poldip3 UTSW 15 83,013,469 (GRCm39) unclassified probably benign
R3755:Poldip3 UTSW 15 83,015,676 (GRCm39) unclassified probably benign
R3756:Poldip3 UTSW 15 83,015,676 (GRCm39) unclassified probably benign
R4785:Poldip3 UTSW 15 83,015,702 (GRCm39) missense probably damaging 1.00
R4917:Poldip3 UTSW 15 83,016,776 (GRCm39) critical splice donor site probably null
R4965:Poldip3 UTSW 15 83,021,706 (GRCm39) missense possibly damaging 0.80
R5009:Poldip3 UTSW 15 83,017,395 (GRCm39) missense probably damaging 1.00
R5030:Poldip3 UTSW 15 83,022,392 (GRCm39) missense possibly damaging 0.67
R5992:Poldip3 UTSW 15 83,013,430 (GRCm39) missense probably damaging 0.96
R6638:Poldip3 UTSW 15 83,017,401 (GRCm39) missense probably damaging 1.00
R7028:Poldip3 UTSW 15 83,015,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTAATGAGAGGCCTGTCCAC -3'
(R):5'- TGAAGCCTTTGGTCACACG -3'

Sequencing Primer
(F):5'- GAGAGGCCTGTCCACAACCTC -3'
(R):5'- TGTACTCGTGTGTCGCAC -3'
Posted On 2022-04-18