Incidental Mutation 'R9378:Unc13b'
ID 709762
Institutional Source Beutler Lab
Gene Symbol Unc13b
Ensembl Gene ENSMUSG00000028456
Gene Name unc-13 homolog B (C. elegans)
Synonyms Unc13h2, Munc13-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9378 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 43058953-43264871 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 43173282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 1370 (I1370K)
Ref Sequence ENSEMBL: ENSMUSP00000147100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569]
AlphaFold Q9Z1N9
Predicted Effect probably benign
Transcript: ENSMUST00000079978
SMART Domains Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1262 1404 4.8e-60 PFAM
C2 1438 1544 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107952
SMART Domains Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1033 2.02e-53 SMART
Pfam:Membr_traf_MHD 1274 1416 4.8e-60 PFAM
C2 1450 1556 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107953
SMART Domains Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 179 193 N/A INTRINSIC
low complexity region 292 303 N/A INTRINSIC
low complexity region 322 333 N/A INTRINSIC
C1 478 527 4.21e-18 SMART
C2 601 708 2.07e-22 SMART
DUF1041 917 1021 2.02e-53 SMART
Pfam:Membr_traf_MHD 1263 1403 2.3e-56 PFAM
C2 1457 1563 7.56e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163653
SMART Domains Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456

DomainStartEndE-ValueType
C2 3 94 1.2e-9 SMART
low complexity region 191 205 N/A INTRINSIC
low complexity region 304 315 N/A INTRINSIC
low complexity region 334 345 N/A INTRINSIC
C1 490 539 4.21e-18 SMART
C2 613 720 2.07e-22 SMART
DUF1041 929 1032 4.64e-53 SMART
Pfam:Membr_traf_MHD 1273 1415 4.8e-60 PFAM
C2 1449 1555 7.56e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000207569
AA Change: I1370K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
2210408I21Rik A G 13: 77,323,616 K1047E possibly damaging Het
Abca14 A T 7: 120,207,968 Y79F possibly damaging Het
Abca2 T A 2: 25,439,082 M978K probably benign Het
Adamts3 A T 5: 89,700,410 C684* probably null Het
Adnp2 T C 18: 80,129,422 T591A probably benign Het
Aff4 A T 11: 53,372,479 T109S probably damaging Het
Agmo A G 12: 37,243,721 I48V probably benign Het
Appl1 G A 14: 26,927,827 R581* probably null Het
Armc9 A T 1: 86,262,044 M714L probably benign Het
Atp6v0d2 T A 4: 19,922,377 T41S probably benign Het
Bin1 A T 18: 32,419,868 Q182L probably damaging Het
Bmp10 A G 6: 87,433,702 D159G probably benign Het
Bsn G A 9: 108,107,655 P295S possibly damaging Het
C130079G13Rik A G 3: 59,931,689 T11A possibly damaging Het
Cbx6 A G 15: 79,828,405 S274P probably damaging Het
Cdc20b A G 13: 113,056,097 K108R probably benign Het
Ces1d T A 8: 93,186,096 N238I probably damaging Het
Col7a1 C T 9: 108,958,640 Q663* probably null Het
Cpsf3 T C 12: 21,308,038 I517T possibly damaging Het
Cyp2a5 C A 7: 26,840,454 T309N probably damaging Het
Cyp2d40 A G 15: 82,761,601 F68L possibly damaging Het
Cyp7b1 A T 3: 18,096,673 W301R probably damaging Het
Dnah6 T A 6: 73,212,530 N45I probably benign Het
Dnah7a A T 1: 53,582,617 H1116Q probably benign Het
Dntt A G 19: 41,038,917 N141S probably benign Het
Fbxl13 T C 5: 21,585,203 N281D probably damaging Het
Frem2 A T 3: 53,651,989 L1699H probably damaging Het
Gabrr3 T C 16: 59,461,674 V464A possibly damaging Het
Gdap1 T A 1: 17,157,129 I160N probably damaging Het
Hnrnpll C A 17: 80,061,862 R44L unknown Het
Hsp90ab1 T C 17: 45,570,754 E187G probably damaging Het
Ighm T A 12: 113,422,590 T47S Het
Itgb7 A C 15: 102,227,396 probably null Het
Kif16b A T 2: 142,619,818 C1293* probably null Het
Klf11 C T 12: 24,655,044 R166C probably benign Het
Lca5l T A 16: 96,176,012 Q198L probably damaging Het
Lnx2 A T 5: 147,024,370 M584K probably benign Het
Lpp A T 16: 24,721,987 M1L probably benign Het
Lrig3 A G 10: 125,997,084 T276A probably damaging Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Megf8 A T 7: 25,340,415 probably null Het
Myh1 A C 11: 67,202,433 T117P probably damaging Het
Neb C A 2: 52,244,101 R3290L possibly damaging Het
Neb A C 2: 52,247,292 V220G Het
Nktr A T 9: 121,748,198 K444I probably damaging Het
Nol11 A T 11: 107,173,679 M483K probably benign Het
Npy1r C A 8: 66,704,209 P94T probably damaging Het
Nsmaf T C 4: 6,440,940 T37A probably benign Het
Olfr1137 C A 2: 87,711,079 V276F possibly damaging Het
Olfr1224-ps1 T C 2: 89,157,055 N40S probably damaging Het
Olfr131 G A 17: 38,082,165 A271V possibly damaging Het
Olfr160 A G 9: 37,712,177 I34T probably damaging Het
Olfr286 A G 15: 98,227,039 L204P possibly damaging Het
Olfr624 A T 7: 103,670,182 M283K probably damaging Het
Olfr884 G A 9: 38,047,479 V86M possibly damaging Het
Palld C T 8: 61,516,657 R1211H unknown Het
Pcdha3 A G 18: 36,947,231 D342G probably damaging Het
Pclo G A 5: 14,765,863 V1266I Het
Pcnx4 T C 12: 72,555,890 Y309H probably damaging Het
Pde8a C T 7: 81,332,871 T746I probably damaging Het
Pdzrn3 T G 6: 101,150,811 K965Q probably damaging Het
Phldb1 G A 9: 44,704,128 A225V probably benign Het
Plat A G 8: 22,775,583 Y214C probably damaging Het
Plppr1 T A 4: 49,325,627 C274* probably null Het
Poglut1 A G 16: 38,526,771 F345L possibly damaging Het
Ppara A T 15: 85,777,636 E26V possibly damaging Het
Ppcdc A T 9: 57,420,288 W79R probably damaging Het
Prdm1 C T 10: 44,440,154 C662Y probably damaging Het
Sgms2 G A 3: 131,342,362 probably benign Het
Slc31a1 T A 4: 62,388,606 M133K probably damaging Het
Smg1 G A 7: 118,178,775 Q1309* probably null Het
Sos1 T C 17: 80,453,810 I152M probably damaging Het
Stk4 A T 2: 164,110,216 probably benign Het
Syne1 T G 10: 5,250,954 N3538T probably damaging Het
Tbc1d16 A G 11: 119,208,840 F236S probably damaging Het
Tgs1 T A 4: 3,595,475 M548K probably benign Het
Twf1 G A 15: 94,585,455 T124I probably damaging Het
Tyro3 G A 2: 119,812,167 G611R probably damaging Het
Usp40 A G 1: 87,957,310 W939R probably damaging Het
Vamp8 A T 6: 72,385,571 V82E probably damaging Het
Vmn2r17 A G 5: 109,427,866 H201R possibly damaging Het
Whrn T C 4: 63,431,842 H546R probably benign Het
Yeats2 T C 16: 20,214,478 V1036A probably benign Het
Zfp352 T G 4: 90,224,338 N238K probably benign Het
Zfp36l3 TCCAGGGGCGAGGGCAGCCCCAGGAGCAAGGGCCGCCCTAGGAATGAGGGCCGCCCCAGG TCCAGG X: 53,774,554 probably benign Het
Zfp462 T A 4: 55,011,510 S1159T probably benign Het
Zscan4-ps1 A T 7: 11,066,265 H232Q probably benign Het
Other mutations in Unc13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Unc13b APN 4 43240285 missense probably damaging 1.00
IGL00832:Unc13b APN 4 43258921 missense probably damaging 1.00
IGL01111:Unc13b APN 4 43096927 missense possibly damaging 0.76
IGL01115:Unc13b APN 4 43258492 missense probably damaging 1.00
IGL01137:Unc13b APN 4 43091291 missense probably damaging 1.00
IGL01637:Unc13b APN 4 43241066 missense probably damaging 1.00
IGL01789:Unc13b APN 4 43239462 missense probably damaging 1.00
IGL01792:Unc13b APN 4 43250218 missense probably damaging 0.99
IGL01877:Unc13b APN 4 43249583 critical splice donor site probably null
IGL01924:Unc13b APN 4 43239385 nonsense probably null
IGL02087:Unc13b APN 4 43091270 missense probably null 1.00
IGL02197:Unc13b APN 4 43165828 missense probably damaging 0.99
IGL02504:Unc13b APN 4 43263031 missense probably damaging 1.00
IGL02659:Unc13b APN 4 43235332 missense probably damaging 1.00
IGL03031:Unc13b APN 4 43235368 missense probably damaging 1.00
IGL03036:Unc13b APN 4 43235249 missense probably damaging 1.00
IGL03209:Unc13b APN 4 43239351 missense probably damaging 0.99
IGL03352:Unc13b APN 4 43237110 missense possibly damaging 0.90
BB006:Unc13b UTSW 4 43174399 missense unknown
BB016:Unc13b UTSW 4 43174399 missense unknown
G1Funyon:Unc13b UTSW 4 43263568 missense probably benign
P0028:Unc13b UTSW 4 43256225 missense probably damaging 1.00
PIT4585001:Unc13b UTSW 4 43091298 missense probably benign 0.03
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0019:Unc13b UTSW 4 43096990 missense possibly damaging 0.58
R0335:Unc13b UTSW 4 43236983 missense possibly damaging 0.95
R0504:Unc13b UTSW 4 43263559 missense probably damaging 0.99
R0631:Unc13b UTSW 4 43182849 missense possibly damaging 0.47
R0748:Unc13b UTSW 4 43241164 splice site probably benign
R1275:Unc13b UTSW 4 43235366 missense probably damaging 1.00
R1293:Unc13b UTSW 4 43235190 missense probably damaging 1.00
R1434:Unc13b UTSW 4 43239385 nonsense probably null
R1552:Unc13b UTSW 4 43237144 missense probably damaging 0.99
R1591:Unc13b UTSW 4 43244747 missense probably damaging 1.00
R1628:Unc13b UTSW 4 43263371 missense probably damaging 1.00
R1740:Unc13b UTSW 4 43240285 missense probably damaging 1.00
R1839:Unc13b UTSW 4 43258308 splice site probably benign
R2045:Unc13b UTSW 4 43091266 missense probably damaging 1.00
R2191:Unc13b UTSW 4 43245566 nonsense probably null
R2259:Unc13b UTSW 4 43182780 missense possibly damaging 0.87
R2307:Unc13b UTSW 4 43239854 missense probably damaging 0.98
R2317:Unc13b UTSW 4 43245514 missense probably damaging 1.00
R2402:Unc13b UTSW 4 43095843 missense probably benign
R2847:Unc13b UTSW 4 43180404 missense probably benign 0.04
R3414:Unc13b UTSW 4 43234658 splice site probably benign
R3436:Unc13b UTSW 4 43097028 splice site probably benign
R3955:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R3957:Unc13b UTSW 4 43256834 missense probably damaging 1.00
R4015:Unc13b UTSW 4 43237801 missense probably damaging 1.00
R4650:Unc13b UTSW 4 43261035 missense probably damaging 0.97
R4836:Unc13b UTSW 4 43237137 missense probably damaging 1.00
R5041:Unc13b UTSW 4 43237836 missense probably benign 0.41
R5413:Unc13b UTSW 4 43257936 critical splice donor site probably null
R5994:Unc13b UTSW 4 43172596 intron probably benign
R6015:Unc13b UTSW 4 43177995 nonsense probably null
R6090:Unc13b UTSW 4 43239306 missense probably damaging 1.00
R6242:Unc13b UTSW 4 43165800 missense possibly damaging 0.92
R6246:Unc13b UTSW 4 43216246 missense probably benign 0.18
R6427:Unc13b UTSW 4 43176966 unclassified probably benign
R6660:Unc13b UTSW 4 43177412 unclassified probably benign
R6670:Unc13b UTSW 4 43255562 missense probably damaging 0.99
R6753:Unc13b UTSW 4 43239331 missense probably damaging 1.00
R6858:Unc13b UTSW 4 43165828 missense possibly damaging 0.85
R6886:Unc13b UTSW 4 43170156 intron probably benign
R6969:Unc13b UTSW 4 43263538 missense possibly damaging 0.94
R6994:Unc13b UTSW 4 43171403 intron probably benign
R6994:Unc13b UTSW 4 43173203 intron probably benign
R7080:Unc13b UTSW 4 43171926 missense unknown
R7117:Unc13b UTSW 4 43216544 missense probably benign 0.33
R7132:Unc13b UTSW 4 43215757 missense probably benign 0.17
R7181:Unc13b UTSW 4 43258893 missense probably damaging 0.99
R7192:Unc13b UTSW 4 43258519 missense probably damaging 1.00
R7246:Unc13b UTSW 4 43172910 missense unknown
R7342:Unc13b UTSW 4 43258703 missense probably damaging 0.99
R7345:Unc13b UTSW 4 43173966 missense unknown
R7355:Unc13b UTSW 4 43237754 missense probably damaging 1.00
R7391:Unc13b UTSW 4 43216459 missense probably benign 0.03
R7419:Unc13b UTSW 4 43174023 missense unknown
R7424:Unc13b UTSW 4 43172235 missense unknown
R7517:Unc13b UTSW 4 43215765 missense probably benign
R7532:Unc13b UTSW 4 43249565 missense probably benign 0.44
R7564:Unc13b UTSW 4 43091258 missense probably damaging 1.00
R7598:Unc13b UTSW 4 43263569 missense probably benign 0.20
R7604:Unc13b UTSW 4 43170102 missense unknown
R7604:Unc13b UTSW 4 43256776 missense possibly damaging 0.95
R7643:Unc13b UTSW 4 43216333 missense probably benign
R7718:Unc13b UTSW 4 43173854 missense unknown
R7735:Unc13b UTSW 4 43165791 missense probably damaging 1.00
R7756:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177312 small deletion probably benign
R7757:Unc13b UTSW 4 43177330 small insertion probably benign
R7757:Unc13b UTSW 4 43177341 small insertion probably benign
R7758:Unc13b UTSW 4 43177312 small insertion probably benign
R7758:Unc13b UTSW 4 43177344 small insertion probably benign
R7781:Unc13b UTSW 4 43259546 missense possibly damaging 0.87
R7793:Unc13b UTSW 4 43172737 missense unknown
R7858:Unc13b UTSW 4 43176285 missense unknown
R7867:Unc13b UTSW 4 43232573 nonsense probably null
R7897:Unc13b UTSW 4 43171860 missense unknown
R7904:Unc13b UTSW 4 43217075 missense probably benign
R7929:Unc13b UTSW 4 43174399 missense unknown
R7984:Unc13b UTSW 4 43173973 missense unknown
R8069:Unc13b UTSW 4 43177597 missense unknown
R8101:Unc13b UTSW 4 43239918 missense probably benign 0.08
R8246:Unc13b UTSW 4 43175954 missense unknown
R8289:Unc13b UTSW 4 43172524 nonsense probably null
R8301:Unc13b UTSW 4 43263568 missense probably benign
R8397:Unc13b UTSW 4 43217290 missense probably benign 0.12
R8421:Unc13b UTSW 4 43178304 missense unknown
R8738:Unc13b UTSW 4 43177564 missense unknown
R8746:Unc13b UTSW 4 43176120 missense unknown
R8766:Unc13b UTSW 4 43174722 missense unknown
R8825:Unc13b UTSW 4 43237683 splice site probably benign
R8834:Unc13b UTSW 4 43175954 missense unknown
R8862:Unc13b UTSW 4 43235207 missense probably damaging 1.00
R8864:Unc13b UTSW 4 43174724 missense unknown
R8889:Unc13b UTSW 4 43176484 missense unknown
R8892:Unc13b UTSW 4 43176484 missense unknown
R8904:Unc13b UTSW 4 43178531 intron probably benign
R9089:Unc13b UTSW 4 43095847 missense probably damaging 1.00
R9144:Unc13b UTSW 4 43173649 missense unknown
R9149:Unc13b UTSW 4 43176186 missense unknown
R9173:Unc13b UTSW 4 43177421 missense unknown
R9200:Unc13b UTSW 4 43257352 missense possibly damaging 0.50
R9232:Unc13b UTSW 4 43240321 missense probably benign 0.03
R9269:Unc13b UTSW 4 43171955 missense unknown
R9320:Unc13b UTSW 4 43171044 missense unknown
R9335:Unc13b UTSW 4 43216123 missense possibly damaging 0.86
R9335:Unc13b UTSW 4 43255551 missense probably damaging 0.99
R9352:Unc13b UTSW 4 43177312 small insertion probably benign
R9352:Unc13b UTSW 4 43177313 nonsense probably null
R9382:Unc13b UTSW 4 43172512 missense unknown
R9569:Unc13b UTSW 4 43177312 small deletion probably benign
R9622:Unc13b UTSW 4 43172513 missense
R9687:Unc13b UTSW 4 43174920 missense unknown
R9704:Unc13b UTSW 4 43237102 missense probably benign 0.31
R9721:Unc13b UTSW 4 43101869 missense probably benign
R9753:Unc13b UTSW 4 43182842 nonsense probably null
RF016:Unc13b UTSW 4 43177347 small insertion probably benign
RF016:Unc13b UTSW 4 43177350 small insertion probably benign
RF041:Unc13b UTSW 4 43177338 small insertion probably benign
RF056:Unc13b UTSW 4 43177359 small insertion probably benign
Z1176:Unc13b UTSW 4 43171419 missense unknown
Z1176:Unc13b UTSW 4 43177191 missense unknown
Z1176:Unc13b UTSW 4 43177764 missense unknown
Z1176:Unc13b UTSW 4 43261043 missense probably benign 0.11
Z1177:Unc13b UTSW 4 43173669 missense unknown
Predicted Primers PCR Primer
(F):5'- TTCTGAGAACCTGAGGAGCC -3'
(R):5'- AGGCCACAAGAAAGCATCTG -3'

Sequencing Primer
(F):5'- GCCAGGTTGAAAACAATGTAGCTTC -3'
(R):5'- CATCTGCTGATGGAAATGTATTTTG -3'
Posted On 2022-04-18